Question

7. An animal virus can enter animal cells and hijack the gene expression system to encode for its proteins. What sequence do we expect to find in the promoter region of viral own genes? A. 35 region B. 10 region C. TATA box D. None of the above

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans. Given, it is an animal virus. The animal cell is an eukaryotic cells.

So, if a virus want to hijack animal cell machinery for transcription by using eukaryotic RNA polymerase, the viral gene must have promotor sites similar to that of the eukaryotic gene.

Because eukaryotic RNA polymerase bind to eukaryotic promotors only, the viral gene must share similarity in promotor sites with eukaryotic genes. Note than eukaryotic RNA polymerase can’t bind efficiently with a prokaryotic gene and vice-verse because of different in the promoter sequences between eukaryotic and prokaryotic gene.

The promotors listed here, -35 region and -10 region (TATA box) are those of a prokaryotic gene.

So, none of these promotors need to be present in the viral gene because the virus has to encode proteins in an eukaryotic cell, NOT in prokaryotic cell.

Correct option: D. None of the above

Add a comment
Know the answer?
Add Answer to:
An animal virus can enter animal cells and hijack the gene expression system to encode for...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 3 (1 point) Which of the following correctly describes how expression or function of MYC...

    Question 3 (1 point) Which of the following correctly describes how expression or function of MYC happens? (Don't worry about correct capitalization or type style in this question.) O A chromosomal translocation that puts an active promoter region for antibody genes in close proximity to the myc gene, leading to overproduction of MYC. The avian myelocytomatosis virus carries an altered version of myc (v-myc) that is hyperactive. The virus genome integrates into the host genome and the altered form of...

  • The human immunodeficiency virus (HIV) causes AIDS, a disease of the immune system that culminates in...

    The human immunodeficiency virus (HIV) causes AIDS, a disease of the immune system that culminates in death. To mount a successful invasion, the HIV virus must bind to a protein known as CCR5 that resides on the surface of immune cells. Individuals that are homozygous for a deletion of the CCR5 gene are completely protected from HIV infection. The CCR5 gene is transcriptionally silenced by Xp1, a negative regulator of CCR5 that is expressed everywhere but the immune system. Given...

  • The following is a diagram of the LCT (lactase gene) gene regulation system in humans. When...

    The following is a diagram of the LCT (lactase gene) gene regulation system in humans. When the LCT gene is transcriptionally active, the cell produces the enzyme lactase, which is needed to digest the lactose in many dairy products. Based on what you know about enhancers and promoters from your reading, predict how the following scenarios might influence LCT gene expression and thus lactase production in cells: The enhancer sequence is inverted, but remains intact so that Oct1 still binds...

  • synergism Page 2 of 5 Rabibove love 18. The Spectrum of cells a virus can infect...

    synergism Page 2 of 5 Rabibove love 18. The Spectrum of cells a virus can infect is defined as the host mange. Which of the following viral pathogens has the widest host range? & Hepatitis B adsorbs to human liver calls & Poliovirus attaches to intestinal and nerve cells c Rabies attaches to several cells of many mammals a all the above C none of the above 19. In Persistent infections, the cell harbors the virus, which is not immediately...

  • Yet, all the cells in your body contain the same genes (and same alleles). The difference...

    Yet, all the cells in your body contain the same genes (and same alleles). The difference across cell types is that genes get selectively expressed (turned on or off) based on the proteins needed for cellular function given their environment. Select which statement explains the reason why hair does not normally grow on your muscle cells. a. Muscle cells have the gene for keratin, but do not express it b. Muscle cells do not have the gene for keratin and...

  • Cancer and Gene Regulation Why is a cell cycle control system needed for cell division? What...

    Cancer and Gene Regulation Why is a cell cycle control system needed for cell division? What happens when cells do NOT respond to the cell cycle control system and divide excessively? Tumor Proto-oncogeno (for protein that stimulates coll division) 6 Y DNA Benign Tumor= Mutation withln a control region of DNA Malignant Tumor Mutated promoter Metastasis Normal growth-stimulating protein in excess Oncogene Tumor-Suppressor Genes Proto-oncogene utled tara gese Samor-auppresr gane Many proto-oncogenes code for growth factors /Deletive nonimenig Normel grewt...

  • Sorry for bad grammar, English is not my native language. For question 11 what is a...

    Sorry for bad grammar, English is not my native language. For question 11 what is a haploid yeast cell? If the cell lacks the promoter in the first then will it always be true that  expression will not occur despite the UAS sequence? What is a UAS sequence? For question number 13 response b how/why when a promoter is closer to a consensus sequence more transcription occurs? 11. Galactose dependent transcription is regulated by the Gal4 transcription factor which binds...

  • Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

    Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...

  • 5. Here is another promoter region in E. coli. (Also in a larger format in the...

    5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...

  • Visualizing in live cells (6 pts + 1 bonus) Look at the expression/reporter constructs depicted below....

    Visualizing in live cells (6 pts + 1 bonus) Look at the expression/reporter constructs depicted below. Each gene is named (and individually colored), and each one has its own promoter (also individually colored). Note that the cassette labeled "D" is illustrated under two different conditions (Di and Dii). Glutaminase Parvalbumin tTA mcherry mcherry mCherry 1. Is mCherry normally expressed? le, in it's natural state, is it "on" or "off"? (0.5) 2. Why is the green hexagon molecule important in Dii?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT