Question
28
28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low l

29
29. (Use this representation to answer the following question.) DNA template strand 5 3 DNA complementary strand 3 5 Using

30
2:037 . 1:02:44 Exit 30. (Use this representation to answer the following question.) DNA template strand 5 3 DNA complementa

31

31. Alternative mRNA splicing... can allow the production of similar proteins from different pre-mRNAs. is a mechanism for in

32

32. The TATA box is said to be highly conserved in evolution. Which of the following might this illustrate? The sequence evol

33
33. The polymerase enzyme used in PCR is called E. coli polymerase Taq polymerase. Bacillus thuringiensis polymerase. Human p
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question 28 :-

The right option is option (b) expressed at low levels or not at all

Explanation :- Heterochromatin is the region of the DNA which is highly coiled and condensed. This means that the DNA is not readily available for RNA polymerase to transcribe it. Thus it is expressed much lower. The opposite of heterochromatin is Euchromatin in which transcription rate is high.

Question 29 :-

The right option is option (a) 3' to 5' along the template strand.

Explanation :-

Firstly, RNA polymerase uses Template strand hence the name template strand. So it will move on it. Now the new RNA which is created, is in 5' to 3' direction and since DNA strands are complimentary, it mean the orientation of the template strand will be opposite. So if new stand is synthesized in 5' to 3' direction, that means DNA template Orienation will be 3' to 5'

Question 30 :-

The right option is option (b) To the right of the template strand.

Explanation :-

Promoter is present before the start codon of DNA. And since the start point is 3" end, then it will be before that. That is right to the 3' end. Hence the promoter will be to the right of 3' end of template strand.

Question 31:-

The right option is option (D) can allow the production of different sizes of protein and function from a single pre-mRNA

Explanation:-

In splicing, introns are removed while exons are kept in a mRNA. While in alternate splicing, some exons are removed too. Now, exons are the part of mRNA which codes for protein. Suppose a mRNA have 5 exons namely :- A B C D E. Now different combinations can be made like A B C D or A C D E or A B D and so on. So using alternative splicing, cells can use one mRNA to create different types of mature mRNA which will code for different proteins with different size and function.

Question 32:-

The right option is option (c) Any mutation in the sequence is highly selected against

Explanation :-

Conserved sequence means that it is almost universal and found in a wide variety of organisms across Genera, phylum and kingdom. But it doesn't mean that it can not mutate because the fact is that mutation is random and any sequence of DNA is equally probable to be mutated. But, cells can prevent mutation not by stopping mutation but by selecting against it. It means if a cell have a mutation in one of the important, conserved gene, the resulting cell or organism will not survive and die. Thus, it will not pass on the mutation to its possible progeny. Hence, the selection opposes accumulation of mutation in conserved genes.

Question 33 :-

The right option is option (B) Taq polymerase.

Explanation :-

In PCR, which uses a thermocycler and the temperature is raised to as high as 94° Celsius, the proteins in the solution can be degraded by heat. Because proteins, especially enzymes are very sensitive to temperature changes. Actually, earlier scientists has to add polymerase enzyme after every cycle. But now we uses polymerase enzymes from those bacteria which survive in high temperature like in Hot water spring because their proteins are resistant to high temperature.

Taq polymerase is extracted from a bacteria called Thermus aquaticus and it is found in Hot water springs at high temperatures.

Add a comment
Know the answer?
Add Answer to:
28 29 30 31 32 33 28. Genes found in segments of chromosome called heterochromatin would...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The...

    1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...

  • 11. A gene is best defined as a. A segment of DNA b. Three nucleotides that...

    11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....

  • Why would changes in the genes for transcription factors be expected to generate major phenotypic differences?...

    Why would changes in the genes for transcription factors be expected to generate major phenotypic differences? They are extremely powerful genes. They can affect the expression of small numbers of other genes. Their gene products are remarkably stable. Their gene products normally denature more rapidly than other gene products. They can affect the expression of large numbers of other genes. Which enzyme, also responsible for siRNA formation, carves miRNAs from their double-stranded, fold- back RNA precursor (pre-miRNA)? Dicer ribonuclease RNA...

  • In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase...

    In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase to pause, facilitating termination. rho binds the mRNA, and when it makes contact with RNA polymerase, it assists with the removal of the mRNA from the DNA template. the rho factor binds to the -10 consensus sequence located in the promoter region to terminate transcription. a site within the poly(A) tail is cleaved which signals termination. the 3' untranslated region (3" UTR) is synthesized....

  • DNA polymerases are processed, which means that they remain tightly associated with the while moving rapidly...

    DNA polymerases are processed, which means that they remain tightly associated with the while moving rapidly and adding nucleotides to the growing daughter strand. Which piece of the machinery accounts for this characteristic? (a) helicase (b) sliding elamp (c) single-strand binding protein (d) primase RNA in cells differs from in that _____ (A) it contains the base uracil, which pairs with cytosine (b) it is single stranded and cannot form base pairs (c) it is single stranded and can fold...

  • QUESTION 1 George Beadle and Edward Tatum performed an experiment in which they made single-gene mutations...

    QUESTION 1 George Beadle and Edward Tatum performed an experiment in which they made single-gene mutations in the bread mold Neurospora crassa. These mutations resulted in several Neurospora auxotrophs. Further analysis revealed specifically how the mutations affected synthesis of the amino acid in question. What was the significance of these results? A single gene encodes a single protein, in the case of this experiment, an enzyme. Enzymes are needed to synthesize amino acids. They showed that mutations are heritable. They...

  • 5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the...

    5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...

  • 1. How is the start codon identified in prokaryotic cells? a. It is the only AUG...

    1. How is the start codon identified in prokaryotic cells? a. It is the only AUG on the mRNA strand. b. It is the AUG after the Shine-Dalgarno sequence. c. It is the AUG right next to the promoter on the mRNA. d. It is the AUG after the Kozak sequence. e. It is the AUG nearest the 5' end of the mRNA. 2. All of the following are true for eukaryotic transcription EXCEPT: a. Transcription can be terminated when...

  • Which of the following statements is FALSE? Nucleotides are only ever linked to one another 5’...

    Which of the following statements is FALSE? Nucleotides are only ever linked to one another 5’ to 3’ DNA can contain Uracil as a result of a chemical reaction MutS/MutL only works to repair the lagging strand of synthesis Alternative splicing happens in every eukaryotic gene All of these statements are false The protein that phosphorylates the CTD to initiate transcription is called EF-Tu eIF4 TFIID TFIIH RNA polymerase Which of these enzymatic activities in DNA replication require the input...

  • QUESTION2 Which of the following statements is TRUE? O DNADNA hybrids and RNADNA hybrids are always...

    QUESTION2 Which of the following statements is TRUE? O DNADNA hybrids and RNADNA hybrids are always antiparallel O DNA is replicated using the template strand as the template but RNA is transcribed using the sense (or coding) strand as the template. O Both DNA and RNA polymerization require a primer O Introns get spliced out of DNA and out of pre-mRNA QUESTION 3 0. Which of the following statements is FALSE? O Only Eukaryote genes have an A/T rich core...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT