Question

1. The figure below shows a DNA double helix and its nucleotide sequence.

A. A homodimeric helix–turn–helix protein binds to a DNA fragment containing this sequence. Its preferred half-site is AACAC. Show where the two recognition helices in the protein contact the DNA.

B. Are protein–DNA contacts primarily in the major or the minor groove of DNA? What parts of the nucleotides contact the amino acid side chains of the protein to provide most sequence specificity? What kind of bond is primarily responsible for specific protein–DNA interactions?

C. If 5 base pairs are inserted in the middle of a binding site for a dimeric helix–turn–helix protein, binding is abolished. If 10 base pairs are inserted, binding is sometimes preserved, albeit with lowered affinity. Explain these observations.

CGCATAAAATAACACCGTGCGTGTTGTA GCGTATTTATTGTGGGCACGCACAACAT

0 0
Add a comment Improve this question Transcribed image text
Answer #1

A. The two recognition helices in the protein contact the DNA at CA.

B. Protein-DNA contacts primarily one in the major groove and one in the minor groove of DNA. A hydrogen- bonding complementary between the bases that contact the DNA at the Alfa-helical region and amino acid side chains of protein provides the correct matching.

C.If the bases are mismatched then the helix-turn-helix protein binding is abolished, but if the bases pairs match the nucleotide base pairing then the helix is preserved.

Add a comment
Know the answer?
Add Answer to:
1. The figure below shows a DNA double helix and its nucleotide sequence. A. A homodimeric...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The recognition of specific DNA sequences by proteins is thought to depend on two types of...

    The recognition of specific DNA sequences by proteins is thought to depend on two types of mechanisms: one that involves the formation of hydrogen bonds with specific bases, primarily in the major groove, and one involving sequence-dependent deformations of the DNA helix. By comprehensively analyzing the three-dimensional structures of protein-DNA complexes, we show that the binding of arginines to narrow minor grooves is a widely used mode for protein-DNA recognition. This readout mechanism exploits the phenomenon that narrow minor grooves...

  • Select the phrases that accurately describe properties of the most common form of the DNA double helix

    Select the phrases that accurately describe properties of the most common form of the DNA double helix. There is more than one correct answer. Select all that apply. DNA contains equal amounts of adenine and thymine, and equal amounts of cytosine and guanine. A helical turn consists of about 10 nucleotides. Base pairs have a spacing of 20 A. The phosphodiester bonds between nucleotide residues run in opposite directions in the two strands. The nitrogenous bases are exposed to the solvent, whereas the sugar-phosphate backbone of...

  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

  • 25. In the base in the figure below, which includes the l'carbon of ribose, the number...

    25. In the base in the figure below, which includes the l'carbon of ribose, the number of atoms which are the hydrogen donors in base-pairing H-bonds is ___ A. O B. 1. C. 2 D. 3. E. 4 26. The N-terminal end of the DNA-binding homodimer zipper protein illustrated below is at the left. Amino acid residue 100 is marked. The residue # for the sidechain at the arrow is - A. 106 B. 107 C. 108 D. 93 E....

  • Question 8 1 pts Base pairing is an essential property of a DNA helix. Its presence...

    Question 8 1 pts Base pairing is an essential property of a DNA helix. Its presence or absence is very important for all of the following EXCEPT: Establishing the 5' to 3' polarity of a piece of DNA Providing a primer for DNA polymerase. Identifying an origin of replication. Identification of a damaged nucleotide that needs to be repaired. The use of a template to make a new daughter strand Question 9 Primase is an essential component of the replication...

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • Here is all the information and content! One of the questions which shows a double stranded...

    Here is all the information and content! One of the questions which shows a double stranded sequence and asks for the mRNA sequence has not correct answer. It should be dropped. Anyone who majored in Bio can answer these 2nd-year biology multiple questions (only Q14 has more than one answer). Thanks a lot!!!!!   Question This type of RNA does not participate in the splicing reaction, but is important for efficient functioning of the spliceosome. Not yet answered Marked out of...

  • can u tell me if these answers are correct please!??!!! Choose the best answer for the...

    can u tell me if these answers are correct please!??!!! Choose the best answer for the following questions. Place your answer on the line. If your answer is not on the line.it does not count 1 Mender's discovery that characteristics are inherited due to the transmission of hereditary factors resulted from his (1) dissections to determine how fertilization occurs in pea plants (2analysis of the offspring produced from many pea plant crosses (3) careful microscopic examinations of genes and chromosomes...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT