RNA polymerase enzyme would be most susceptible to inhibition by this drug because Cordycepin is a adenosine analog which act as substrate for RNA polymerase which further inhibits the polymerization step.
The molecule shown below' inhibits the synthesis of a certain type of polynucleotide Based on your...
Question 5 Your friend is an amateur mushroom hunter. He accidentally eats an Amanita phalloides "Death Cap" mushroom and becomes very ill. You recall from university that this mushroom is toxic because it contains a aminitin, a noncompetitive inhibitor of RNA polymerase. Which of the following hypothetical treatments (if they were possible) would NOT help your friend? Select all best answers for full credit Injecting more RNA polymerase into his cells. Injecting a drug that binds the enzyme-binding region a...
Please help with a-e
The data below describes the synthesis of PGG2, a
prostaglandin precursor molecule, by a COX enzyme in the presence
and absence of ibuprofen. Ibuprofen has a molecular weight of 206
g/mol. (Please see photo for data chart)
a. Determine the Vmax and KM of the enzyme with no
ibuprofen.
b. Determine the Vmax and KMapparent of the enzyme in the
presence of ibuprofen.
c. Based on your answers to a and b, what type of inhibition...
A DNA molecule has many phosphate groups, as shown below What type of amino acid side chains would be most likely be involved in binding this substrate at the active site? Select one polar, negatively charged polar, positively charged hydrophobic polar neutral
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
5. Based on your understanding of the mechanism of proteases A. the figure below shows a part of the active site of the enzyme chymotrypsin. what are the identities of amino acids x and Y and what is this particular type of spatial arrangement of amino acids called? Alkoxide on X ? B. from the strucutres shown below, identify the two that represent the first and the second tetrahedral intermediates in the chymotrypsin catalyzed reaction. what type of attack and...
please answer All the multiple choice questions in the pic (all
pics) i dont need a explantion .
22 Using a bacteriophage to pass DNA rom bacterium to another O A) Transduction O B) Transformation C) Translocation O D) Translation 23. What research did Rosalind Franklin contribute to the elucidation of the double helix structure of DNA? O O O A) Principles of base pairing B) Biochemical data C) Bacterial transformation data D) X ray crystallography A segment of DNA...
5. Robinson used his annulation reaction in the total synthesis of cholesterol that he published in 1951. (His interest in the synthesis dated back to 1932!) The synthesis was very important for the synthesis of other steroids. Describe in words what is changing from reactants to products in each step and provide the reagents necessary for each conversion. MeMe Me. SH HO Cholesterol (a steroid!) The number of stereoisomers of a molecule can be predicted (in most cases) by using...
4. In a lake governed by the food web shown in the image to the right, 500 brown trout are added from fisheries. Which of the following outcomes would most likely be expected? A. Tadpole population will increase B. Duck population will decrease C. Algae population will increase D. Lilly Pad population will decrease E. Caddis Fly larvae will increase 5. Which of the following pieces of evidence most strongly supports a common ancestor of all life on Earth? A....
can
u tell me if these answers are correct please!??!!!
Choose the best answer for the following questions. Place your answer on the line. If your answer is not on the line.it does not count 1 Mender's discovery that characteristics are inherited due to the transmission of hereditary factors resulted from his (1) dissections to determine how fertilization occurs in pea plants (2analysis of the offspring produced from many pea plant crosses (3) careful microscopic examinations of genes and chromosomes...
Please need help answering question A the pages of background
information are posted thanks
Read page 196-197 and figure 6.20. regarding Meselson and
Stahl’s experiment regarding DNA replication. And Answer the
following question
If you are using this radioactive technique in mouse cells,
what would happen in each phase of G1, S, G2, mitosis and meiosis
assuming that you are grown cells in 15N medium for many
generations and cells in G1are then switched to 14N medium?
G1
S
G2...