Question

42 6 (13 pts total). The diagram below shows a structure of an eukaryotic gene. Each pattern the following: a. enha coding sequence, tl -transcription stop, 12 -translation stop refers to a different part of a gene. Using the patterm, label the diagram for the location of tnenhancer, b- promoter, c- transcription start, d- translation start; e- exon, i- intron, f- n 9 pts Put the corresponding letter on top of the pattern to show the location b. 2 pts) How pre-mENA transcribed from this gene will lok like? You may use letters b. (2 pts) How pre-mRNA transcribed from this gene will look like? You may use letters or diagram as above c. mature mRNA? (2 pts)
0 0
Add a comment Improve this question Transcribed image text
Answer #1

After cleavage of introns and rearrangement of exons finally the mRNA will look like this-

Figure 15.8b-3 Proximal control Transcription Poly-A signal sequence elements start sion Intron Exon Intron Exon Exon Intron

all the arrangement of the above mentioned sequences can be seen here in this imageThe Transcriptional unit enhancer 1000 b translation start translation exons 20-30b stop ranscriptional umit (g 3 CT 5 se i

Add a comment
Know the answer?
Add Answer to:
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • please help with this genetics question! i really need help 1. Diagram a eukaryotic gene containing...

    please help with this genetics question! i really need help 1. Diagram a eukaryotic gene containing three exons and two introns. Your diagram should show DNA and the mature mRNA molecules. Show the following (if it exists in the DNA indicate so, if it exists in the mature mRNA, indicate so): a. AG and GU dinucleotides corresponding to intron-exon junctions b. +1 TSS C. 5' and 3' UTRS d. the start codon sequence e. the stop codon sequence f. the...

  • B. (10pts) Gene expression can be regulated in many ways. In the gene below, each letter...

    B. (10pts) Gene expression can be regulated in many ways. In the gene below, each letter represents a different mutation. Indicate which mutation would: (Use each letter only once.) trigger non-sense mediated decay increase transcript stability result in aberrant splicing reduce mRNA expression levels alter ADAR RNA editing promoter D — transcribed region intron A intron E exon- transcription factor binding sites exon spliced mRNA T 5'UTR CDS 3'UTR start codon stop codon C. (8pts) UAU encodes the amino acid...

  • Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...

    Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...

  • 3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...

    3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...

  • Define the different elements comprising a eukaryotic “gene body," whether or not copies of these different...

    Define the different elements comprising a eukaryotic “gene body," whether or not copies of these different elements are present in mature mRNA, and whether or not they code for protein. If you can include a photo with labels and include the terms transcriptional start site, 5' untranslated region (UTR), start codon, intron, exon, stop codon, and 3' untranslated region, that'd be great!!

  • 6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures...

    6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...

  • answer parts e, f, and g 4. Look at the following diagram of a eukaryotic gene...

    answer parts e, f, and g 4. Look at the following diagram of a eukaryotic gene Polyadenylation anal region (100bpl ADNA 11,000 pl (1000bp) Con 1450b) chel 1750 a) At which section would transcription initiation occur? List the letter of the section. (0.5pts) b) Identify all sections that would be present in the pre-mRNA transcribed from this gene. List the letter of these sections. (0.5pts) c) Name the three processes that must occur to create a mature processed mRNA in...

  • Hint 1. How is a complete initiation complex formed? Drag the labels to their correct locations...

    Hint 1. How is a complete initiation complex formed? Drag the labels to their correct locations in the diagram to describe the roles of the various transcription factors in the formation of a complete initiation complex Reset Help part of initial committed complex TFIIA IIB added during formation of minimal initiation complex sa cosci.ccccccca RNA polymerase II added during formation of complete initiation complex Submit Request Answer Hint 2. How is pre-mRNA processed into mature mRNA? Select the two statements...

  • 3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop...

    3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...

  • Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter...

    Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter region is indicated by the dotted box. Transcriptions begins immediately following the promoter. The mature mRNA produced by this gene would be approximately how many nucleotides long? A) 100 B) 200 C) 3000 D) 5000 E) 7000 1. Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter region is indicated by the dotted box. Transcription begins immediately...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT