Question

Predict where each mutant protein will go (as in, final destination), based on the set of...

Predict where each mutant protein will go (as in, final destination), based on the set of sorting sequences it has.

Hint: think about what set of sorting sequences the normal, unmutated protein would have, then think about what sorting sequences the protein would have after the changes are made. Then, figure out where a protein with these new sorting sequences would end up.

      -       A.       B.       C.       D.       E.       F.       G.   

a cytoskeletal protein, with MTS added to it

      -       A.       B.       C.       D.       E.       F.       G.   

Cyt-P450 enzyme, with the ER-RS removed

Hint: we learned about the function of P450 in the slides.

      -       A.       B.       C.       D.       E.       F.       G.   

Oligosaccharyl transferase, with the ER-SS and ER-RS removed

Hint: oligosaccharyl transferase adds the initial oligosaccharide (initial glycosylation)

      -       A.       B.       C.       D.       E.       F.       G.   

DNA polymerase, with the NLS swapped out and replaced with ER-RS

      -       A.       B.       C.       D.       E.       F.       G.   

glucocerebrosidase, with no M6P tag

A.

ER

B.

cytoplasm

C.

golgi

D.

secreted

E.

stuck forever inside a vesicle

F.

nucleus

G.

mitochondria

0 0
Add a comment Improve this question Transcribed image text
Answer #1
  • a cytoskeletal protein, with MTS added to it      = cytoplasm
  • Cyt-P450 enzyme, with the ER-RS removed    = mitochondria
  • Oligosaccharyl transferase, with the ER-SS and ER-RS removed= cytoplasm
  • DNA polymerase, with the NLS swapped out and replaced with ER-RS = ER
  • glucocerebrosidase, with no M6P tag= golgi
Add a comment
Know the answer?
Add Answer to:
Predict where each mutant protein will go (as in, final destination), based on the set of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A protein is made on the rough ER of a cell. Which of the following is...

    A protein is made on the rough ER of a cell. Which of the following is least likely to be true about this protein? A. Its signal peptide was removed. B. It began its synthesis in the cytoplasm. C. It is secreted from the cell. D. It is a cytoskeletal protein. E. It is made of amino acids linked by peptide bonds.

  • 23. A protein called Ras is tethered (linked) to the plasma membranes of stem cells where...

    23. A protein called Ras is tethered (linked) to the plasma membranes of stem cells where it participates in signal transduction pathways that affect stem cell proliferation. Which of the following covalent modifications would be responsible for tethering (linking) the Ras to the membrane? A. Phosphorylation B. Glycosylation C. Lipid modification D. Ubiqutiylation E. Acetylation 24. What do transmembrane proteins in the peroxisome, nucleus, and mitochondria all have in common? A. They are all co-translationally inserted into the membrane B....

  • please answer me this Consider a membrane protein destined for the plasma membrane. From a hydropathy...

    please answer me this Consider a membrane protein destined for the plasma membrane. From a hydropathy plot, you determine the protein has the following general structural elements: • • • 5 Trans-membrane domains (boxes 1-5) 6 soluble domains (wavy lines A-F) Flanking charges around trans-membrane domain 1. (A positive charge is towards the N-terminus, and a negative charge is towards the C-terminus.) You find that soluble domains B and E contain possible glycosylation sites. Ntorm in an ammo u arom...

  • 11. When a protein is completely hydrolyzed the following occurs (hint-think about the bond structure) a....

    11. When a protein is completely hydrolyzed the following occurs (hint-think about the bond structure) a. water is removed b. the primary structure is not affected c. individual amino acids are products d. water is a product e. none of the above 12. (27) Circle the appropriate answer. Each is worth 3 points. a. True or False Sphingosine is a sidechain of some complex lipids. b. True or False It is best to have a higher HDL and lower LDL...

  • 3. Think about what G-proteins look like before they bind to a G-protein-coupled receptor. These G-proteins...

    3. Think about what G-proteins look like before they bind to a G-protein-coupled receptor. These G-proteins would have...circle your answer GTP attached to them OR GDP attached to them (a) Think about what G-proteins look like after they bind to a G-protein-coupled receptor. These G-proteins would have...circle your answer GTP attached to them OR GDP attached to them (b) A molecule of GTP contains how many phosphate groups? (c) Think about a G-protein that has a GTP attached to it....

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • 4. The protein shown below is an enzyme-linked receptor. This means that this protein... Circle your...

    4. The protein shown below is an enzyme-linked receptor. This means that this protein... Circle your answer a) can speed up chemical reactions. b) can bind to certain signaling molecules. c) all of the above. D. Think about the enzyme-linked receptor we discussed in class. After the signaling molecules binds to this receptor, it causes the active site on the receptor to become available. What binds to this active site? E. Consider the molecule you named in the previous question....

  • a-d plz 7. Protein purification. As a graduate student, the first protein I purified was RNA...

    a-d plz 7. Protein purification. As a graduate student, the first protein I purified was RNA polymerase (RNAP) from E. coli- Some physical and chemical properties of Ecoli RNAP Molecular max470,000 g/mol polynentide compasitian (subunits): (50 kDa), k andok a pl = 5.34 substrates: NTPs cofactor: Mg? Purification protocol. E coli cells were broken usine Isozyme, yielding a cellualar extract containing a protcome solution 4M (NHOSO, was added to the cellular extract. A white protein precipitate was formed incuding RNAM...

  • a. Which spot corresponds to the protein with the largest molecular weight? b. When pH = 7, what order would the follow...

    a. Which spot corresponds to the protein with the largest molecular weight? b. When pH = 7, what order would the following peptides elute from a column filled with cation exchange resin? Size exclusion column? Protein 1 – 400 kDa; 10%A 5%E, 5%F, 10% G, 5% H, 10%I, 10%K, 10%L 10%R, 5%P, 5%S, 10%W, 5%Y Protein 2: 40 kDa 5%A, 5%C, 5%D, 5%E, 5%F, 10%G, 5%I, 10%K, 5%L, 5%M, 5%N, 10%P, 5%R, 5%S, 5%T, 5%V, 5%W, Protein 3 – 175...

  • 7. Protein purification. As a graduate student, the first protein I purified was RNA polymerase (RNAP)...

    7. Protein purification. As a graduate student, the first protein I purified was RNA polymerase (RNAP) from E. coli. Some physical and chemical properties of E. coli RNAP Molecular mass = 470,000 g/mol polypeptide composition (subunits): a (50 kDa), B (150 kDa) and 6 (70 kDa) pl = 5.34 substrates: NTPS cofactor: Mg Purification protocol. E. coli cells were broken using lysozyme, yielding a cellualar extract containing a proteome solution. 4M (NH4)2SO4 was added to the cellular extract. A white...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT