write the amino acid sequence of your protein. Indicate the start and stop sites
Answer : Start site Stop site
Codon : 5' AUG GCU AGA AAU GAU UGU CAA GAA GGU CAU AUU GUU UAG 3'
Amino terminal : Methionine - alanine-arginine-asparagine -aspartic acid - cysteine - glutamine -glutamic acid -glycine - histidine -isoleucine - valine - STOP CODON Carboxy terminal
Amino acid sequence :
write the amino acid sequence of your protein. Indicate the start and stop sites
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Find the two other segments of the sequence among your classmates that will complete the protein. For example if you have a middle segment you will need to find a beginning and an end segment. Write the entire linear order of amino acids in Part 2, Question l in your proforma, (using the single letter amino acid abbreviation). Start with the beginning segment, followed by the middle segment and lastly, the end segment. Indicate the amino (NH2) and carboxyl (COOH)...
Question 6 Using the provided Genetic Code, determine the amino acid sequence of a protein when the mRNA is AUGAUUGACUGA. Tyrosine – threonine – valine – glutamic acid Methionine - STOP Methionine – isoleucine – aspartic acid – STOP Lysine – arginine – glycine - STOP
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
1. How can protein folding affect protein function? 2. How can amino acid sequence affect protein function? 3. How can an amino acid sequence (primary sequence) dictate 3D protein structure?
A specific stretch of DNA that programs the amino acid sequence of a protein is a A. nucleic acid B. protein C. gene D. enzyme
QU. 5. You have identified the complete amino acid sequence on protein sequencing techniques. "Y" is composed of 44 amino acids with the po below. No information is available about its genetic sequence. Your task sequence for protein "Y". Assume that the gene sequence is unique in the human 5 BRIEFLY EXPLAIN methodically and accurately how you will decipher the gene seg "Y". (3 POINTS). no acid sequence of a human protein called "Y" using 1.44 amino acids with the...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
In bacteria and eukaryotes, a mutation is when ________. the amino acid sequence in a protein molecule is directly changed the nucleotide sequence in an mRNA molecule is directly changed the nucleotide sequence in a DNA molecule is directly changed the expression of a gene changes without the DNA sequence being changed
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...