“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this...
“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this sequence. Hint 1 – DNA must first be transcribed into messenger RNA. Hint 2 – Your ANSWER will be written in amino acids not nucleotides!
TAC AAT ACA ACT
Homework Answers
ANSWER: TAC AAT ACA ACT- DNA nucleotide sequence will be transcribed into mRNA as AUG UUA UGC UGA.
The final products for this seauence will be Methionine Leucine Cystine Stop.
Add Answer to:
“translate” the following DNA nucleotide sequence into the amino
acids that would be produced from this...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what...
9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what will the RNA codon be? What amino acid and/or function does this RNA codon code for? What RNA codon(s) code for the amino acid arginine (ARG)? What RNA codon codes for tryptophan (TRP)? What was the DNA sequence that was transcribed to make this codon? (backwards transcribe it) If the last nucleotide (letter) in the TRP codon changes to a "U," will the amino...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary
A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino...
A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino acids. What would be the impact of these mutations on the protein? 1) GCATCTACGCGATGAATATT 2) GCATCTACGCCATCAATATT 3) GCATCTACGCCATG TATATT
A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino...
A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino acids. What would be the impact of these mutations on the protein? 1) GCATCTACGCGATGAATATT 2) GCATCTACGCCATCAATATT 3) GCATCTACGCCATG TATATT
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
Examine the following nucleotide sequence from the sense strand of DNA. What is the amino acid...
Examine the following nucleotide sequence from the sense strand of DNA. What is the amino acid sequence of the encoded protein? (Show work) ATG - CCT - TAC - GCC - CCT - GGA - GAC - GAA - AAG - AAG - GGT
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a....
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what will the RNA codon be? What amino acid and/or function does this RNA codon code for? What RNA codon(s) code for the amino acid arginine (ARG)? What RNA codon codes for tryptophan (TRP)? What was the DNA sequence that was transcribed to make this codon? (backwards transcribe it) If the last nucleotide (letter) in the TRP codon changes to a "U," will the amino...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago