HomeworkLib
Question

QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho

media%2F884%2F88419c60-b07a-485c-b51b-8e

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

WT DNA sequence: TACGGCAGTCCTTCTGCAACT
WT RNA sequence: AUGCCGUCAGGAAGACGUUGA
WT protein sequence: Met-Pro-Ser-Gly-Arg-Arg-stop

After the removal of the second G in the second codon
Mutant DNA sequence: ATGCGTCAGGAAGACGTTGA
Mutant RNA sequence: AUGCGUCAGGAAGACGUUGA
Mutant protein sequence: Met-Arg-Gln-Glu-Asp-Val-stop

0 0
Add a comment
Know the answer?
Add Answer to:
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

    mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • The DNA sequence shown encodes the last amino acids of a protein that has a total...

    The DNA sequence shown encodes the last amino acids of a protein that has a total of 270 amino acids. The bolded base pairs indicate the translation reading frame. 5’ …….GCT AAG TAT TGC TCA AGA TTA GGA TGA TAA ATA ACT TGG 3’ 3’ …….CGA TTA ATA ACG AGT TCT AAT CCT ACT ATT TAT TGA ACC 5’ Which is the template strand for transcription? Explain.

  • 7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary...

    7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary RNA sequence: Write the 3-letter amino acid sequence:

  • “translate” the following DNA nucleotide sequence into the amino acids that would be produced from this...

    “translate” the following DNA nucleotide sequence into the amino acids that would be produced from this sequence. Hint 1 – DNA must first be transcribed into messenger RNA. Hint 2 – Your ANSWER will be written in amino acids not nucleotides! TAC AAT ACA ACT

  • PART C.  Use your codon chart to determine the amino acid sequence.  Remember to read through the strand...

    PART C.  Use your codon chart to determine the amino acid sequence.  Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop.  Follow example below: Example:                  DNA à  AGA CGG TAC CTC CGG TGG GTG CTT  GTC  TGT  ATC CTT  CTC  AGT  ATC               mRNA à  UCU GCC AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG               protein à                   start - glu – ala –thre – hist – asp –glu – threo - stop                                                                                                                                               acid                              acid 5.   DNA à  CTA TTA CGA TAC...

  • An mRNA sequence of 18 nucleotides codifies for a polypeptide containing___. 18 amino acids 56 amino...

    An mRNA sequence of 18 nucleotides codifies for a polypeptide containing___. 18 amino acids 56 amino acids 6 amino acids 36 amino acids

  • The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a....

    The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...

  • i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this...

    i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.

  • Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...

    Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT