1. Five different bases and codon length of one results in a maximum of 5 codons, and five different bases and codon length of two results in a maximum of 25 codons.
Which mathematical formula represents the relationship between the number of bases, codon length, and number of codons possible? (number of bases = n
codon length = L)
number of codons: ___________
2. Calculate the minimum codon length needed to define four amino acids. With five bases, what is the minimum codon length needed to specify four codons?
minimum codon length:____________
3. If there are five different types of bases in mRNA instead of four, what will be the minimum codon length needed to specify for 4, 20, and 30 different codons, or amino acids?
4 codons: _____base(s)
20 codons:_____base(s)
30 codons:______base(s)
1. Number of codons = nL where n= number of bases, L= codon length.
2. nL If L= 1 and n=5 , then 51= 5. So minimum codon length needed to specify four codons is 1.
3. According to nL if there are 5 bases and codon length is one 51= 5 minimum length to specify 4 codons is 1.
If there are 5 bases and codon length is 2 then 52 = 25. Minimum length to specify 20 codons is 2.
Likewise if n is 5 and L is 3 then 53 =125, minimum length to specify 30 codons is 3.
1. Five different bases and codon length of one results in a maximum of 5 codons,...
If there are five different types of bases in mRNA instead of four, what would be the minimum codon length needed to specify for four, twenty, and thirty different codons, or amino acids? Four codons: Number basels) Twenty codons: Number basefs) Thirty codons: Number basels) @Previous O Check Answer @Next嘓Exit Hint
JURCU U U This tutorial will take you step-by-step through the question. If there are five different types of bases in mRNA instead of four, what will be the minimum codon length needed to specify for 4, 20, and 30 different codons, or amino acids? Step 5: Calculate the minimum codon length needed to define four amino acids. With five bases, what is the minimum codon length needed to specify four codons? minimum codon length: base(s) Question Source: Pierce 6e...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
22. The wobble rules for tRNA-mRNA pairing are shown in Figure 15.12b. If we assume that the tRNAS do not contain modified bases, what is the minimum number of tRNAs needed to efficiently recognize the codons for the following types of amino acids? a. Leucine b. Methionine c. Serine Phenylalanine Third base of mRNA codon AAG ... Base in anticodon can be U, 1, xm sau. xm Um, Um, xmu.xou, k2C A, G, U. 1, xoSu C, A, U, XOSU...
Question 5 -- / 1 There are different amino acids, and possible codons. 1 3; 20 2 3; 64 3 20; 3 4) 20; 64 5) 64; 3 6 64; 20 Question 6 -- / 1 Which of the following contains an open reading frame (consider the given strand only)? 1 AUGCCCGGGCGAGAC UAUGCGCAACCUGAG N 3 AAAUGAUGACCCAAA 4 UAUGCCGUCGUGAGG 5 UGAUUUCCCGGGCAA Which of the following is true? The initiator tRNA starts in the A site of the ribosome during translation initiation,...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...