You include an innhibitor of the protein kinase activity of TFIIH in an in virto transcription. What step in transcription would you expect to see blocked? Decribe an experiment you would run to test your hypothesis?
Please explain the experiment part to the best of your ability.
Carboxylic terminal domain (CTD) of a RNA polymerase ll undergoes dynamic phosphorylation during transcription cycle.
Phosphorylation of CTD is required for futher steps like promoter clearance and elongation of transcript.
For all these above steps protein kinase of TFIIH is required.
TFIIH is a multiprotein complex which is required for both transcription and DNA repair.
It mainly involves in three functions :
1) phosphorylation of carboxylic end (-COOH) of terminal domain (CTD) of RPB1 subunit of RNA polymerase II.
2) promoter melting
3) promoter clearance
This shows that the inhibition of protein kinase activity of TFIIH leads to blockage of elongation.
The experiment to the test the above hypothesis is G-less cassette assay.
It mainly used to determine the promoter strength.
The above test is usually used to synthesis the transcript of predicatable size using polyacrylamide gel.
In this experiment promoter is fused to double stranded DNA lacking G's in non template strand.
Transcription process undergoes in absence of GTP. Transcription aborts at end of cassette where G is required and produces aborted transcripted of predicatable size.
The formed aborted transcripts electrophoresed and gel is autoradiographed. Based on promoter strength number of aborted transcripts are produced.
But in the above case when inhibitor is added transcription elongation is blocked and there will be sudden decrease in the labelled aborted transcripts.

You include an innhibitor of the protein kinase activity of TFIIH in an in virto transcription....
You hypothesize that your protein of interest moves from the mitochondria to lysosomes when a cell is exposed to the drug Fantasalin. A. Design a microscopy experiment to test this hypothesis. Please include the LABELS and type(s) of microscopy you would use. Also, please draw illustrations of what you predict your experiment to look like. B. Design an experiment to test this hypothesis using cell fractionation and SDS-PAGE. Please include what samples you would collect to run on the gel,...
In the lac operon, what are the likely effects on operon transcription of the mutations listed below? PLEASE EXPLAIN your answers. I think I answered the first part of the question but need help explaining why. Mutation of the consensus sequence in the lac promoter. i. Transcription is blocked. Mutation of the repressor binding sites in the operator sequences. i. Transcription is constitutive. Mutation of the lacI gene affecting the allosteric site of the protein. i. Transcription is blocked. Mutation...
You
perform an assay on the activity of the JAK tyrosine kinase using a
40 microliter aliquot of a lysate prepared from cells labeled for
six minutes with radioactive cysteine. the total volume of the
lysate is 5 milliliters (ml). In the aliquot, you measure the
amount of all proteins and determine the presence of 13 micrograms
of protein in 75 microliters of lysate. which of the following is
the best calculation of the specific activity of the kinase in...
You hypothesize that a protein is localized to the mitochondria in a cell. A. Design a microscopy experiment to test this hypothesis. Please include the labels and types of microscopy you would use. B. How might you test this hypothesis without using a microscopy technique?
QUESTION 4 Which of the following is NOT a mechanisms of protein expression? Specific transcription factors binding to enhancers Export of mRNA into the cytoplasm DNA polymerase phosphorylation 5'UTR secondary structure blocking AUG QUESTION 5 Suppose you have all the necessary proteins for transcription of a gene present AND active/turned on AND in the right location within the cell. Under what conditions would you NOT see transcription of that gene? UmRNA has already been transcribed from that gene but has...
. Gleevec (Imatinib) inhibits protein kinase BCR-ABL, which is
constitutively active in patients with Chronic Myelogenous Leukemia
(CML). The structure of Gleevec is shown below:
a) Based on our discussion in lecture and the structure above,
explain how the “lead” compound structure for Gleevec was designed
and how it led to the development a compound that could bind ABL
with higher affinity than ATP.
b) Using a broad kinase inhibition assay, you discover that
Gleevec inhibits another tyrosine kinase called...
You recently joined a biochemistry research lab to study protein functions in diseases. In the lab, researchers have been working on a protein kinase, the enzyme that catalyzes the phosphoryl transfer reaction from ATP to the -OH group on serine or threonine residues of the target proteins. The researchers in the lab have found that a point mutation in the gene encoding the protein kinase leads to a change in one amino acid of the enzyme, which causes an increase...
You are interested in studying the expression of Neurogenesis-2 (NG-2), a protein that may have a role in neurogenesis in the brain. You know that neurogenesis slows/stops as mice age, so you hypothesize that it will be highly expressed in young mice compared to old mice. (NG-2 is a fake protein used for this test question). Please note that you are being asked to analyze NG-2 at the PROTEIN level. Select appropriate techniques and technologies. (20 pts total). a) Describe...
1. Below is a DNA sequence that encodes a small, hypothetical protein. Assume there are no introns in the coding sequence. Based on what you know about transcription, translation, and cellular trafficking, where would you expect the protein encoded by this gene to localize? Explain your reasoning. ATGATGTCATTCGTATCCCTGCTACTAGTGGGCATTCTGTTCTGGGCGACCGAGGCGGAA CAGCTGACCAAATGCGAAGTGTTTCAGATGGTCTCAAAGGGTGAAGAAGCTGAAGGGCGG CACTCGACAGGTGGCATGGATGAATTGTATAAGAAGGACGAGCTCTAA 2. If you were to mutate the abovementioned gene to disrupt localization of the encoded protein, what mutation(s) would you introduce? Where would you expect the protein to now localize?
Would you expect to see an increase or decrease in total protein concentration in haemorrhage? Explain your reasoning PLEASE answer the question with YOUR OWN WORDS if you are going to copy it from somewhere els, don't answer it please