How many amino acids are encoded by the following mRNA? 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3' The answer given by the...

Question

Question

How many amino acids are encoded by the following mRNA?

5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3'

The answer given by the book is 8, but I cant figure out why. Thanks!

science biology

Answer 1

Answer #1

Answer 2

Similar Homework Help Questions

How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...

How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many...

Question 8 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA codons would be required? Question 9 2.5 pts If a protein (polypeptide) is composed of 210 amino acids, how many mRNA ribonucleotides would be required?
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the...

Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’

Given the following mRNA sequence, 5'–CGCAAGGCCUAU–3?', answer the questions below. A link to a table of...

Given the following mRNA sequence, 5'–CGCAAGGCCUAU–3?', answer the questions below. A link to a table of codons can be found here. Given the following mRNA sequence, 5'-CGCAAGGCCUAU-3', answer the questions below. A link to aa table of codons can be found here a) What amino acid sequence, using the three-letter designations for amino acids, is coded for by the mRNA? b) If a mutation converts AAG to CAG, what is the amino acid sequence? c) What will the amino acid...
A protein consists of 300 amino acids. How many bases will be necessary in the processed...

A protein consists of 300 amino acids. How many bases will be necessary in the processed mRNA, to code for this protein? Assume introns have been extracted from the processed mRNA.
Write the amino acid (Using 1-letter AA codes) sequence encoded by the mRNA base sequence 5′−GAGUUAGUUUGUAAGUGC−3′

Write the amino acid (Using 1-letter AA codes) sequence encoded by the mRNA base sequence 5′−GAGUUAGUUUGUAAGUGC−3′

What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded...

What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded by the DNA? Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
QUESTION 29 How long would a mRNA coding for a protein with 106 amino acids be...

QUESTION 29 How long would a mRNA coding for a protein with 106 amino acids be if it had 5' and 3' UTRs of 30 bases each? (Assume stop codon is part of the last exon)
How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences...

How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences of a protein?

How many amino acids are being linked in the following polypeptide? Label the N-Terminal and C-Terminal...

How many amino acids are being linked in the following polypeptide? Label the N-Terminal and C-Terminal ends of the peptide. Identify the individual amino acids. 5. How many amino acids are being linked in the following polypeptide? Label the N-Terminal and C-Terminal ends of the peptide. Identify the individual amino acids. H2N— C— C— N— C— C— N — — HN NHA