Question

How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...

  1. How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer!

  1. 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′? Explain why the amino acid sequence changes.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

a. Given the polypeptide sequence, Met-Leu-Arg

Methionine has a single codon AUG

Leucine has 6 potential codons UUA,UUG,CUU,CUC,CUA and CUG

Arginine also has 6 potential codons CGU,CGC,CGA,CGG,AGA and AGG

Including the 3 potential stop codons UAA,UAG and UGA

The product of the potential codons of the given polypeptide along with the stop codon gives the total number of possible mRNA sequences.

ie., mRNA sequences.

b. The given sequence is an mRNA sequence.

DNA sequence comprises of four nucleotides Adenine,Guanine, Thymine and Cytosine represented by A,G,T and C respectively

RNA sequence comprises of four nucleotides Adenine,Guanine, Uracil (replaces thymine and base pairs with adenine) and Cytosine represented by A,G,U and C respectively.

The given sequence has Uracil therefore a RNA sequence.

c. 5' GGA GCU CGU UGU AUU 3'

Encoding polypeptide for above sequence is Glycine-Alanine-Arginine-Cystine-Isoleucine.

Changed amino acid sequence is

5'GGA GAC UCG UUG UAU U 3' (the nucleotide A in bold is the mutation)

Encoding polypeptide changes to Glycine-Aspartic acid- Serine- Leucine-Tyrosine

The change in amino acid sequence is due to the insertional mutation (addition of one or more base pair to the sequence). Here base pair A is inserted.

Add a comment
Know the answer?
Add Answer to:
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as...

    The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...

  • Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are...

    Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are these? How do you do the bottom?   Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...

  • S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG...

    S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth

  • This sequence is RNA because:

    20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...

  • Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU -...

    Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' What effect would the following DNA mutation have on the polypeptide synthesized from the gene? DNA template: 3' - GGGTTCGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAAGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' There will be no effect because the codon still calls for the same amino acid. The polypeptide's synthesis will stop too soon because a stop codon has been introduced too early in the sequence. A...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template...

    Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template strand? 3' CATGTACGCATTGAGAACTCGC 5' Asp-His-Ala-Stop-Leu-Leu-Ser Met-Arg-Asn-Ser Met-Arg-Asn-Ser-Ala Met-Tyr-Ala-Leu-Arg-Thr-Arg Asp-His-Ala-Leu-Leu-Ser Asp-His-Ala His-Val-Arg-Ile-Glu-Asn-Ser Met-Arg-Asn-Ser-Stop-Ala Check the orientation of the strands. How do you know which reading frame to use?

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES...

    I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES FROM THE MRNA SEQUENCE. AM I GOING IN THE RIGHT DIRECTION WITH THE DNA SEQUENCES FOR THIS PROBLEM ? 1.The wildtype sequence of part of a protein is: NH2-Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met…             Each mutant in the following table differs from wildtype by a single point mutation (base substitution). Using this information, determine the DNA sequence coding for the wildtype polypeptide. If there is more than one...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT