Question

what is the structure of a nucleotide? what are the compennets of a DNA helix? what...

what is the structure of a nucleotide? what are the compennets of a DNA helix? what is Chargaffs base pir rule?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Nucleotides are basic building blocks of DNA/RNA. It consist of sugar(deoxyribose in DNA and Ribose in RNA), Nitrogen base((cytosine (C), thymine (T), adenine (A), guanine (G) Uracil(U)) and phosphate group.

DNA helix is made up of of six smaller molecules i.e. a five carbon sugar known as deoxyribose, four different nitrogenous bases (A,T,G,C) a phosphate molecule.

Chargaff's rules of base pair in DNA state that DNA from any cell of any organisms should have a 1:1 ratio of pyrimidine and purine and the amount of Guanine should be equal to Cytosine and the amount of Adenine should be equal to Thymine.(i.e . in any cell of any organism the A=T and G=C)

Add a comment
Know the answer?
Add Answer to:
what is the structure of a nucleotide? what are the compennets of a DNA helix? what...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 7 What is the structure of DNA at the level above the nucleotide? Ladder-like double...

    Question 7 What is the structure of DNA at the level above the nucleotide? Ladder-like double helix with sugar phosphate backbone forming the rungs of the “ladder” Single-stranded helical structure with sugar phosphate backbone connecting individual nucleotides Single-stranded helical structure with complementary base pairs connecting individual nucleotides Ladder-like double helix with complementary base pairs forming the rungs of the “ladder”

  • 1. The figure below shows a DNA double helix and its nucleotide sequence. A. A homodimeric...

    1. The figure below shows a DNA double helix and its nucleotide sequence. A. A homodimeric helix–turn–helix protein binds to a DNA fragment containing this sequence. Its preferred half-site is AACAC. Show where the two recognition helices in the protein contact the DNA. B. Are protein–DNA contacts primarily in the major or the minor groove of DNA? What parts of the nucleotides contact the amino acid side chains of the protein to provide most sequence specificity? What kind of bond...

  • What is/are the variable structure(s) of a DNA nucleotide?

    What is/are the variable structure(s) of a DNA nucleotide? Select one: a. The nitrogenous base b. The sugar c. The phosphate group d. The sugar and the base 

  • define nucleotide? 1)define nucleotide 2)summarize the structure of a nucleotide,including the following: a)the three molecules that...

    define nucleotide? 1)define nucleotide 2)summarize the structure of a nucleotide,including the following: a)the three molecules that are bonded together to form a nucleotide. b)show how the carbons of deoxyribose are numbered. c)state which number carbon is bonded to the phosphate d)state which number carbon is bonded to the nitrogenous base 3,define nucleotide,DNA strand,Double stranded DNA,DNA helix 4)state which type of bond connects nucleotides together to form a strand of DNA, and state where that bond is located. 5)state which nitrogenous...

  • 1. Describe how the structure of DNA (double helix and base pair rule) is correlated with...

    1. Describe how the structure of DNA (double helix and base pair rule) is correlated with its role as the molecular basis of inheritance and uniqueness. 2. Discuss how this correlation (above) allows scientists to use DNA for the following area: You will describe DNA technology in the "medical field".

  • QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...

    QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...

  • Describe how the biochemistry of DNA can explain the DNA double helix structure.

    Describe how the biochemistry of DNA can explain the DNA double helix structure.

  • Select the phrases that accurately describe properties of the most common form of the DNA double helix

    Select the phrases that accurately describe properties of the most common form of the DNA double helix. There is more than one correct answer. Select all that apply. DNA contains equal amounts of adenine and thymine, and equal amounts of cytosine and guanine. A helical turn consists of about 10 nucleotides. Base pairs have a spacing of 20 A. The phosphodiester bonds between nucleotide residues run in opposite directions in the two strands. The nitrogenous bases are exposed to the solvent, whereas the sugar-phosphate backbone of...

  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

  • In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

    In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT