what do we all the process of mRNA to "write" the amino acid sequence?

Question

Question

biology

Answer 1

Similar Homework Help Questions

In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid...

In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid sequence of a protein. a) Transcription b) Translation c) Coding d) None of the above
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid...

The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid sequence?
Using the following mRNA sequence, order the amino acids (which it codes for) in the correct...

Using the following mRNA sequence, order the amino acids (which it codes for) in the correct sequence: mRNA: 5' - AUGUACCGAAUUGCCUAA -3' 3_Isoluceine 4 Alanine 1 Tyrosine 2 Stop 5 Methionine 6 Arginine Question 16 RNA polymerase Il promoters are located on theof each transcription unit. https://d21 rose.edu/d21/lmslquizzina/userattemptiquiz start framed2???:136082&isprv-8drc=0&qí 200802&cfq_0&dnb-0 5/6/2018 Quiz Submissions-CH 11 Hw Quiz-BIOL 2103 #2787 (Online) | Cell Biology. Rose State College 1) Outside 2) N-terminal 3) Inside 4) 3 side 5) 5'side

What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...

What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
1. If an mRNA carried a mutation that caused a difference in the amino acid sequence...

1. If an mRNA carried a mutation that caused a difference in the amino acid sequence relative to the wild-type gene product, would the translation machinery recognize this and correct it? Explain. 2. Synthesis of mRNA (transcription) and protein (translation) proceed in an ordered manner, from one end of the molecule to another. What is the polarity of each of these processes? (Use the terms 5', 3', amino, carboxyl.)
QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA?...

QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA? Follow the normal rules for gene expression 5-AGCAAUAUGGCGAUUCGCUGAGUACCU-3 SecondA base UUS Ty UCC UGA CCU CAU CUC CCC First RNA beweisend) Third CO DO CODO<O> RNA base and GU AC U

Write the amino acid (Using 1-letter AA codes) sequence encoded by the mRNA base sequence 5′−GAGUUAGUUUGUAAGUGC−3′

Write the amino acid (Using 1-letter AA codes) sequence encoded by the mRNA base sequence 5′−GAGUUAGUUUGUAAGUGC−3′
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids...

QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho
Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this...

Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this amino acid sequence. Serine-Alanine-Proline-Aspartic acid Use the codon table to answer the question. UCA-GCG-CCC-GAU UCU-GCU-CCU-GAC CCA-GCA-UCC-GAC UCA-GUA-CCA-AAU UCC-GCA-CCA-GAC

Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the...

Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’