Question

Explain how a molecular biologist could determine whether a cut-site was in the middle of an antibiotic-resistance gene.
Explain how restriction enzyme digestion results would change if a foreign gene were inserted into a plasmid.
0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
Explain how a molecular biologist could determine whether a cut-site was in the middle of an...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • The plasmid pFR55 is a useful vehicle for the cloning of any DBA sequence in E....

    The plasmid pFR55 is a useful vehicle for the cloning of any DBA sequence in E. coli. A restriction map of pFR55 showing the restriction enzyme cutting sites is shown below. The plasmid can replicate I'm E. coli and carries the tetracycline resistance Tc and ampicillin resistance (Ap) genes for use as selectable markers in E. coli. a. you wish to insert a gene into the SalI site of pFR55. How would you select for E. Coli cells that have...

  • Explain briefly (and within the context of the plasmid you just created) the role of each...

    Explain briefly (and within the context of the plasmid you just created) the role of each of the 10 elements that are in bold it needs a “ColE1 origin” (E. coli origin of replication) · it needs a “2μ ori” (yeast origin of replication) · a AmpR gene (coding for the bacterial resistance against the antibiotic ampicillin) and its promoter. · a yeast gene coding for the synthesis of uracil and its promoter. · a yeast gene coding for the...

  • You cut the pBad-mTagBFP2 plasmid with the BamHI restriction enzyme only. There is only one BamHI...

    You cut the pBad-mTagBFP2 plasmid with the BamHI restriction enzyme only. There is only one BamHI RE site. How many bands do you expect to see after you run the product on a gel? Would you expect the same result if you cut a linear PCR product that also only has one cut site? Explain your reasoning

  • 7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S...

    7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S pts.). The gene fragment of interest was obtained by digestion of chromosomal DNA with the restriction enzyme Sall and subsequent purification using agarose gel electrophoresis. Which antiblotic would you use in the final step of the cloning procedure, and Pst why? EcoR Sal Ampicillin Tetracycline resistanica(Ter Amp) PBR322 4,361 bp) Origin of replicatiorn (ori Pvull 8. Assume that your gene fragment from question...

  • KpnI (255) lacz alpha gene ECORI (265) Psti (270) PUC origin Smal (3660) рвозобw 3973 bp...

    KpnI (255) lacz alpha gene ECORI (265) Psti (270) PUC origin Smal (3660) рвозобw 3973 bp EcoRI (875) Amp(R) Psti (1550) Kan(R) Ncol (1275) 8. You will be using the plasmid shown above as a vector for a DNA cloning experiment. You will create a library of genomic DNA fragments that will then be ligated into this plasmid. The plasmid carries two antibiotic resistance genes, Amp(R) and Kan(R), an origin of replication and a LacZ gene (Lac Z alpha). The...

  • 4. The vector below is called PUC19. It has a Polylinker site, also called a multiple...

    4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...

  • 63. In cancer cells one allele of the tumor suppressor gene p53 is frequently mutated so...

    63. In cancer cells one allele of the tumor suppressor gene p53 is frequently mutated so that the protein is inactive, not produced, or deleted. The other allele will usually … promoter remains intact but the gene is not expressed. Sequencing with sodium bisulfite modification of DNA can be used to detect which cytosines are methylated. …what would be the anticipated results? Cytosines in or near the promoter region will be methylated Cytosines in or near the promoter will not...

  • The extracted plasmid DNA is pUC19. Look up the plasmid map and include in your pre-lab...

    The extracted plasmid DNA is pUC19. Look up the plasmid map and include in your pre-lab as well as your report. a. What is the location of the BamH1 restriction site? Xmn1 restriction site? (sequence location by number). How many of these sites exist each? b. If single digestions were performed (one restriction enzyme) with BamH1 and Xmn1, respectively, how many fragments would form, and what would be the sizes of each of these fragments? c. If a double digestion...

  • please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping...

    please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...

  • You have isolated a DNA fragment containing a human gene involved in lung cancer and are...

    You have isolated a DNA fragment containing a human gene involved in lung cancer and are working inserting it into a standard plasmid vector used in molecular cloning which has a multiple cloning site in the lacZ gene. After cutting the DNA fragment and the vector with the same restriction enzyme and ligating the cut DNA, you transform bacteria with hopefully the recombinant vector. How do you expect to identify bacteria with the recombinant vector? A. Bacteria with the recombinant...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT