Describe the stages used to transcribe an mRNA molecule in great detail.
Transcription is a process of mRNA synthesis from DNA molecules, where RNA polymerase plays a key role. During the process RNA polymerase uses the template strand (antisense strand or non coding strand) of DNA and synthesizes a complementary RNA molecule using ribonucleoside triphosphates (ATP, CTP, GTP, UTP) as precursors. The RNA produced has the same sequence as the nontemplate strand, which is known to be coding strand or sense strand except that the RNA contains U instead of T. The ultimate prokaryotic transcription occurs in three phases: 1) initiation, 2) elongation and 3)termination.
1 Initiation stage has been subdevided into 4 steps
a. Promoter Recognition by RNA
polymerase holoenzyme (
)
through
factor
b. Binding of holoenzyme to the promoter upstream of the DNA containing two conserved promoter elements, the –10 sequence (TATA box/Pribnow box) with the consensus TATAAT and the –35 sequence with the consensus TTGACA. These promoter sequences which ar e highly conserved between species.
c. Formation of open promoter complexo
d. Formation of first phosphodiester bond of nasent RNA by RNA polymerase holoenzyme. The first nucleotide in the RNA transcript is usually pppG or pppA.
2. Elongation stage has been subdevided into 2 steps
a. Release of
factor: After transcription initiation, the
factor is released from the transcriptional
complex to leave the core enzyme (
)
which continues elongation of the mRNA transcript.
b. Direction of transcription: The
core enzyme contains the catalytic site for polymerization,
probably within the
subunit. The RNA polymerase then synthesizes RNA in the 5’ →3’
direction, involving the four ribonucleoside triphosphates as
precursors. The nucleophilic attack at 3-OH at the end of the
growing RNA chain binds to the phosphate group of the incoming
ribonucleoside triphosphate to form a phosphodiester bond. A
ternary complex is formed by DNA template, RNA polymerase, and new
RNA transcript. The portion of unwound DNA is undergoing
transcription is called the transcription bubble. The RNA
transcript forms a RNA–DNA hybrid (10 - 12 nucleotides long) with
DNA template strand. As transcription proceeds the hybrid then
moves away from the DNA . Further DNA is unwound ahead of the
transcription bubble and the DNA rewinds after the transcription
complex has passed. This process continues until a termination
sequence is reached.
3. Termination stage: The most common termination signal sequence is a GC-rich with a inverted repeat sequence, followed by an AT-rich region in the DNA. The RNA makes self complementary stem loop or hairpin structure from the DNA inverted repeat sequence followed by few or more U residues. The ultimate termination process has been subdevided into 2 parts.
a. Rho dependent termination: In this process, Rho (hexameric protein) help to recognize the termination site and detach the nascent transcript from DNA template, thereby stop transcription.
b. Rho independent termination: In absence of Rho protein, transcript can be detach from the DNA template due to weak A-U bonds between DNA and RNA ahead of hairpin structure.
Describe the stages used to transcribe an mRNA molecule in great detail.
describe in great detail the technique used to determine bacteria sensitivity to antibiotic?
Describe in great detail the regulatory system that was used to express the eyeless gene in flies. Your answer must name the two components of this system, as well as a description of how they work together.
Describe in detail, translation of an mRNA by a ribosome. Include the function of rRNA and tRNA and associated enzymes or complexes.
-Stages of transcription (in detail for each step) - what components are required -Modifications of RNA (on the ends of mRNA, on the interior of mRNA) -why are these modifications important? -Ways to cut out introns (i.e. Splicesomes) -Alternative splicing Translation -TRNA structure and function -What controls accurate translation -wobble effect of tRNAS -general concept of how translation works using mRNA, ribosome, anticodon, tRNA -3 stages of translation (in detail) -initiation -elongation -termination
describe in detail your "perfect" place to study in your home giving great detail to how you would want it including the view, the lighting the desk, ect ect in 500 words
Describe, in great detail, the characteristics of a viable American equity option pricing model. Include detailed discussion of the trades used to exploit the various types of mispricings that could occur in markets.
Read the following and respond: What is the product life-cycle? Describe in detail the four stages. At what stages of the product life cycle is it most important to inject marketing activity? Explain your answer. Is it possible to continually extend a brand to increase the life cycle of a product? Requirements: • Minimum Page Length - 2 full pages (excluding title/header and reference list); 12-point Times New Roma
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
Describe in great detail how turning on your ceiling fan represents the concept of rotational motion and/or torque.
Classify the following statements that describe the stages of bond formation in a hydrogen molecule according? Two hydrogen atoms interact to form a hydrogen molecule. Classify the following statements that describe the stages of bond formation in a hydrogen molecule according to the predominant force existing between the two hydrogen atoms. I need to match the choices below with the right box. Box 1) Attractive force is predominant between the two atoms Box 2) Repulsive force is predominant between the...