Question

Use E-CRISP to design sgRNA for AT3G05330. A. Graphic summary of the result. B. A pair...

Use E-CRISP to design sgRNA for AT3G05330.

A. Graphic summary of the result.

B. A pair of sgRNA sequences, location, and how many hits each one has.

Urgent Thank you I'll upvote!

0 0
Add a comment Improve this question Transcribed image text
Answer #1

AT360 5330 locus_tag = TAN note = protein coding G05327 AT 36205330 Gros3271 AT 205 330-1 0736705 330 6053271 AT7605330 -1-25

Add a comment
Know the answer?
Add Answer to:
Use E-CRISP to design sgRNA for AT3G05330. A. Graphic summary of the result. B. A pair...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 37. What happens when you double-click one of the graphic options in the middle panel of the Choo...

    37. What happens when you double-click one of the graphic options in the middle panel of the Choose a SmartArt Graphic dialog box? a. You are prompted for the location where the graphic should be placed b. You are prompted to choose a design theme for the graphic. c. The graphic is inserted and the SmartArt Tools Design tab is displayed. d. The graphic is previewed but not inserted into the slide. e. None of above 38. To move a...

  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • SUBJECT IS NUTRITION! Need help creating what the new “food pyramid/graphic” should be Please explain what...

    SUBJECT IS NUTRITION! Need help creating what the new “food pyramid/graphic” should be Please explain what each section of the the shape will consist of (example: top of the pyramid would consist of “doughnuts”) I need a new shape! Then if you can explain in 1 page paper length of what the new shape is and the foods in it! This can be any shape! Any help will help! Thank you very much! Need done before 10:30 PM. SATURDAY night...

  • 1. Henry has 28 plastic magnetic letters. He has 3 identical letters A, and exactly one...

    1. Henry has 28 plastic magnetic letters. He has 3 identical letters A, and exactly one of each of the letters B through Z. i. How many sequences of length 6 can Henry form if no letter repeats? For example, BITINA is now allowed because the letter I is used twice. ii. How many sequences of length 6 can Henry form if the letter A is used exactly two times? For example, ADANSK uses the letter A twice. iii. How...

  • For many years, Sinclair Graphic Design has provided design and digital printing services for indoor banners....

    For many years, Sinclair Graphic Design has provided design and digital printing services for indoor banners. The nylon banners, which come in a standard size, are used for a variety of purposes, including trade shows, sporting events, and other promotional activities. Three years ago, the company introduced a second printing and production service for outdoor banners that has become increasingly popular. The outdoor banners are a more complex product than the indoor banners, requiring weatherproof vinyl materials and a different...

  • 1) You have two human liver cells (A and B) and you hypothesize that the insulin...

    1) You have two human liver cells (A and B) and you hypothesize that the insulin receptor gene in Cell A has a mutation in exon 1 and Cell B contains the wild type sequence.  You extract genomic DNA from each of the cells.  Of the following, what would be the most efficient (quick, precise and relatively cheap) way to test your hypothesis. a. Isolate protein from both cells, purify the insulin receptor, and determine the amino acid content. b. Sequence the...

  • can someone solve this question using registers A, B, and R0.. and using basic coded don't use CMP and LEA. thank yo...

    can someone solve this question using registers A, B, and R0.. and using basic coded don't use CMP and LEA. thank you Write an Assembly language program to: A) Store the following text " Welcome to Assembly Language" in the ROM at 200H B) Find how many e letters in this word and store the count in the RAM in location 40H.

  • 1) An organism has 2n = 6 chromosomes with alleles A B / a b on...

    1) An organism has 2n = 6 chromosomes with alleles A B / a b on the chromosome 1 homologous pair, alleles D / d on the chromosome 2 homologous pair, alleles E F / e f on the chromosome 3 homologous pair. Show two different ways that chromosomes could align at the metaphase plate during Meiosis I (show the chromosomes and alleles). Assume no crossing over. How many combinations of chromosomes are possible in the gametes? Please show me...

  • Part 1 Build a pair of replicated, homologous chromosomes. Use ten beads to create each individual...

    Part 1 Build a pair of replicated, homologous chromosomes. Use ten beads to create each individual sister chromatid (20 beads per chromosome pair). Two five-holed beads represent each centromere. To do this: a. Start with 20 beads of the same color to create your first sister chromatid pair. Five beads must be snapped together for each of the four different strands. Two strands create the first chromatid, and two strands create the second chromatid, with a 5-holed bead at the...

  • can someone answer the part b Q8: (8 marks) [basic design problem] Given below is a...

    can someone answer the part b Q8: (8 marks) [basic design problem] Given below is a single node in a neural network. Supposing that d is 4, x={4,2,5,2), and w={0.2,0.3.0.4,0.1), b=0.1, and that the activation function is a standard ReLU, that is =max(0,x), where x is the input to the activation function. b 1 W1 WN X 1 Id (a) What is the output of this node? [2 marks] (b) Describe the difference between, recognition and detection in terms of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT