Homework Answers
Part A 5'-G-C-C-A-C-C-3' is kozac sequence.
PART B: answer is G as it proceeds the START CODON ATG in many of the vertebral species whose sequences have been given
Add Answer to:
The six nucleotides preceding the start codon and the first nucleotide after the start codon in...
5' or or Using the codon table provided, fill in the missing entries in the following...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...
C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Name UNID Class 14 Central Dogma Capstone Worksheet Work together but each student must complete and...
Name UNID Class 14 Central Dogma Capstone Worksheet Work together but each student must complete and turn in their own worksheet. 1. In the sequence grid below, you will be guided through filling in all boxes with end label (polarity or directionality). nucleotide, or amino acid. This sequence is from the middle of a coding sequence, you do not need a start sequence Assume that this table is read from LEFT to RIGHT a. The column to the far left...
Complete the following table and answer the next two questions (3.5 marts) 10 B I =...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Overview The purpose of this activity is to help the students to understand how replication, tran...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status:...
Hello please please help !! Thank you!!
Please and thank you soo
much!!!
Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...
TASK II DNA Sequence DNA was also collected (Table 1). You are going to use this...
TASK II DNA Sequence DNA was also collected (Table 1). You are going to use this DNA sequence to complete the assignment Sacher, tochemelebiT.CO. DA A CARTIE CURIE CRET GARAGE MATIC I GREW E G CARETTING GUITAR HET GRATUIT TE GOOIT GENIET CARTIE CUCINE ACRET GARAGE GOTE GOOIT GRONIE I The DNA examined is 100 nucleotides of mitochondrial sequence, specifically the cytochrome Coxidase subunit I (MT-001) gene. This gene is often used as a DNA barcode to identity/differentiate animals at...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Name UNID Class 14 Central Dogma Capstone Worksheet Work together but each student must complete and turn in their own worksheet. 1. In the sequence grid below, you will be guided through filling in all boxes with end label (polarity or directionality). nucleotide, or amino acid. This sequence is from the middle of a coding sequence, you do not need a start sequence Assume that this table is read from LEFT to RIGHT a. The column to the far left...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
Hello please please help !! Thank you!!
Please and thank you soo
much!!!
Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...
TASK II DNA Sequence DNA was also collected (Table 1). You are going to use this DNA sequence to complete the assignment Sacher, tochemelebiT.CO. DA A CARTIE CURIE CRET GARAGE MATIC I GREW E G CARETTING GUITAR HET GRATUIT TE GOOIT GENIET CARTIE CUCINE ACRET GARAGE GOTE GOOIT GRONIE I The DNA examined is 100 nucleotides of mitochondrial sequence, specifically the cytochrome Coxidase subunit I (MT-001) gene. This gene is often used as a DNA barcode to identity/differentiate animals at...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago