Question

What is the sequence of the first forward primer sequence that you obtain? (You can copy...

  1. What is the sequence of the first forward primer sequence that you obtain? (You can copy and paste it right from the website)

I have a sequence: 1 catgacaact gaagcaaagt gcccttttct acatcccgcc ggcgctggcc gggcgctcca

   61 ggaatggtgg cccgagcgcc tgaatctgca tatcctgcgc cagaacgctc cgttgtccga

121 tccgatggga gaggctttcg attatgcgaa ggcgtttaac agtctcgacc tcgcggcggt

181 caagaaggat ctggaagcgc tgatgaccga ttcgcagtcc tggtggccgg cggatttcgg

241 gcactacggc ccgttgttcg tccggatggc ctggcacgcg gcaggtacct accgcatcgg

301 cgatgggcgt ggcggtgccg gcgctggcca gcagcgtttc gcgcccacca acagctggcc

361 ggacaacgtc agtctggaca aggcacgcag gctcatctgg ccgatcaagc agaaatacgg

421 ccgcaagatc tcgtgggccg acctgatcgt tctgacgggc aatgttgccc tggagtcgat

481 ggggttcaag accttcggat tcggcggcgg acgcgaggat gtctatgagc cggacgagtc

541 cgtctactgg ggcaatgaag ccgagtggct ggcggacaag cgttacagcg gtaaccggaa

601 cctcgagaat ccgctggctg cggtgcagat gggcctgatc tatgtaaatc cggaaggccc

661 caatggcaac ccggacccgg ttgccgccgc catcgacatc cgcgagacgt tccgccgcat

721 ggccatgaac gacgaagaaa ccgtcgcgct gatcgcgggc ggtcatgcct tcggcaagac

781 gcatggcgcc ggccccgcat cgcacgtggg gcccgagcct gaagccgcgg gcctcgagga

841 gcagggcctt ggctggcgca gcagctttgg caccggcaag ggcggtgatg ccatcggcag

901 tggcctggag gtcatctgga ccaccacgcc gacgaagtgg agcaacgact tcttcaagca

961 cctgttcgag tacgaatggg aattgacgaa gagccccgcg ggcgcacatc aatggaagcc

   1021 aaagggcaat gccggcgccg gcaccgtgcc cgaccctgcc gacccgtcga agcgccgttc

   1081 gccctcgatg ctgacgaccg atctgtcgct gcgcttcgat tcgatctacg gcaagatttc

   1141 gcgccggtac tacgatcatc ccgatgagct ggccgacgca ttcgcacggg cgtggttcaa

   1201 gctgacccat cgcgacatgg ggccgcgcgc gcgctacctt ggcccggaag tcccgaagga

   1261 ggaactcctg tggcaagacc ccatcccgcc ggttgatcat ccgctgatcg acgcgaagga

   1321 tgtcgccgcg ctcaaggcca aggtgcaggc ttcggggctg accgtgccgc aactggtttc

   1381 gacggcgtgg gcgtcggctt cgacgttccg tggctcggac aagcgcggtg gcgccaacgg

   1441 cgcgcgcatc cgcctggccc cgcagaagga ctgggacgtc aatcagcctg ccgaactggc

   1501 gaaggtgctg gtcaagctgg agagcatcca gagcgagttc aacaaggcgc agagcggtgg

   1561 caagaaggtc tcgatggctg acctgatcgt gctggccgga tgcgcgggcg tcgagcaggc

   1621 ggcaaagagc gccgggcagg atgtgacggt gccgttctcg ccgggacgca tggacactac

   1681 gcaggagaaa acggacctgg atgcgatggt ggtgctggaa cccatcgcag atggtttccg

   1741 caactacctg cagggcaagt tctcggtccg ggccgaggcc ttgctggtgg acaaggcgca

   1801 actgctgaag ctgaccgtgc cggagatgac ggcgcttgtc ggtggactgc gggtgctggg

   1861 cgccaacttc ggcaactcgc agcacggcgt cttcacgaaa cgccctggca cgctgaccaa

   1921 cgacttcttc gtgaacctgc tcgacatggg cacggagtgg aagccagtgt cggaggaaag

   1981 agaggtgttc gagggcagcg accgggcgac gggcacgcca agatggaccg gcacgcgcgt

   2041 cgatctggtc ttcggctcga actccgagct gcgggcggtt gccgaggtct atggtgcggc

   2101 ggacgcgcag gagaagttcg tgcaggactt cgtggcggcg tggagcaagg tgatgaacct

   2161 ggaccgcttc gatctcaagt g

  1. What is the sequence of the first reverse primer?- acctcgcgggccggtcgcggccgccctacatcttttcccgtgaaacgaagtcaacagtac
  1. Do the primers meet the parameters for primer design?

2. Do the primers range from 17-28 nucleotides in length? What is the length of each primer?

3. Does the base composition have 40-60% (G+C)? What is the composition of each primer?

4. Are the melting temperatures (Tm) between 52-62º C? What are the Tm for each primer?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

1. Open NCBI primer blast https://www.ncbi.nlm.nih.gov/tools/primer-blast/ and paste the sequence in the PCR template window OR on the analyze this sequence on right hand side select the pick the primer option.

2. Keep all the settings in the default except the following ones.
3. In the Primer parameters, Primer size set maximum to 200.
4. Set the temperature to min 59, opt 62,max 65 and Max Tm difference 3
5. Check intron inclusion.
6. Select homo sapiens in the Organism box or paste the taxonomy id number of humans in the box.
7. Click on ‘Get Primers’.

Results:

Primer pair 1

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer GTAAATCCGGAAGGCCCCAA Plus 20 644 663 60.03 55.00 6.00 0.00
Reverse primer TTTCCTCCGACACTGGCTTC Minus 20 1979 1960 59.97 55.00 3.00 0.00
Product length 1336

Primer pair 2

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TGGCCATGAACGACGAAGAA Plus 20 720 739 59.97 50.00 6.00 0.00
Reverse primer ATCGCATCCAGGTCCGTTTT Minus 20 1707 1688 60.04 50.00 3.00 0.00
Product length 988

Primer pair 3

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer ATCGTTCTGACGGGCAATGT Plus 20 446 465 60.04 50.00 3.00 1.00
Reverse primer TTGGGGCCTTCCGGATTTAC Minus 20 663 644 60.03 55.00 6.00 0.00
Product length 218

Primer pair 4

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer AAAACGGACCTGGATGCGAT Plus 20 1688 1707 60.04 50.00 3.00 3.00
Reverse primer CTTTCCTCCGACACTGGCTT Minus 20 1980 1961 59.96 55.00 3.00 0.00
Product length 293

Primer pair 5

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer GGATGTCTATGAGCCGGACG Plus 20 517 536 60.04 60.00 4.00 2.00
Reverse primer GGGCTCTTCGTCAATTCCCA Minus 20 996 977 60.04 55.00 4.00 0.00
Product length 480

Primer pair 6

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer GATGACCGATTCGCAGTCCT Plus 20 202 221 59.90 55.00 5.00 2.00
Reverse primer ACATTGCCCGTCAGAACGAT Minus 20 465 446 60.04 50.00 3.00 2.00
Product length 264

Primer pair 7

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TACGCAGGAGAAAACGGACC Plus 20 1678 1697 60.04 55.00 3.00 3.00
Reverse primer AAGAAGTCGTTGGTCAGCGT Minus 20 1929 1910 59.90 50.00 4.00 2.00
Product length 252

Primer pair 8

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer ATGTTGCCCTGGAGTCGATG Plus 20 462 481 60.11 55.00 4.00 3.00
Reverse primer GACAGATCGGTCGTCAGCAT Minus 20 1107 1088 59.90 55.00 8.00 2.00
Product length 646

Primer pair 9

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TCTTCGTGAACCTGCTCGAC Plus 20 1926 1945 60.04 55.00 4.00 2.00
Reverse primer GTTCGAGCCGAAGACCAGAT Minus 20 2062 2043 59.83 55.00 6.00 2.00
Product length 137

Primer pair 10

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TCAAGACCTTCGGATTCGGC Plus 20 486 505 60.11 55.00 4.00 2.00
Reverse primer AGCCATCGAGACCTTCTTGC Minus 20 1579 1560 60.11 55.00 4.00 2.00
Product length 1094

Primer pair 11

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer GCAAGAAGGTCTCGATGGCT Plus 20 1560 1579 60.11 55.00 4.00 2.00
Reverse primer CTTGAGATCGAAGCGGTCCA Minus 20 2179 2160 59.83 55.00 4.00 3.00
Product length 620

Primer pair 12

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer CGCCGGTACTACGATCATCC Plus 20 1142 1161 60.11 60.00 5.00 3.00
Reverse primer ACTTGAGATCGAAGCGGTCC Minus 20 2180 2161 59.83 55.00 4.00 3.00
Product length 1039

Primer pair 13

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TGATGACCGATTCGCAGTCC Plus 20 201 220 60.18 55.00 5.00 1.00
Reverse primer GCCGAATCCGAAGGTCTTGA Minus 20 505 486 60.11 55.00 4.00 2.00
Product length 305

Primer pair 14

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TCAATGGAAGCCAAAGGGCA Plus 20 1009 1028 60.18 50.00 4.00 0.00
Reverse primer GGATGATCGTAGTACCGGCG Minus 20 1161 1142 60.11 60.00 5.00 3.00
Product length 153

Primer pair 15

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer ATCTGGAAGCGCTGATGACC Plus 20 189 208 60.18 55.00 6.00 2.00
Reverse primer CAACATTGCCCGTCAGAACG Minus 20 467 448 60.11 55.00 4.00 3.00
Product length 279

Primer pair 16

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer GAGCATCCAGAGCGAGTTCA Plus 20 1522 1541 59.83 55.00 2.00 1.00
Reverse primer GAGCCGAAGACCAGATCGAC Minus 20 2058 2039 60.25 60.00 4.00 2.00
Product length 537

Primer pair 17

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer ATGTAAATCCGGAAGGCCCC Plus 20 642 661 59.81 55.00 6.00 2.00
Reverse primer GGGATGATCGTAGTACCGGC Minus 20 1162 1143 59.76 60.00 5.00 2.00
Product length 521

Primer pair 18

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer CGATGGGAGAGGCTTTCGAT Plus 20 123 142 59.61 55.00 5.00 3.00
Reverse primer TCATCAGCGCTTCCAGATCC Minus 20 206 187 59.89 55.00 6.00 2.00
Product length 84

Primer pair 19

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TGATCGACGCGAAGGATGTC Plus 20 1305 1324 60.25 55.00 4.00 2.00
Reverse primer CCATCGAGACCTTCTTGCCA Minus 20 1577 1558 59.75 55.00 4.00 3.00
Product length 273

Primer pair 20

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TCGTTCTGACGGGCAATGTT Plus 20 447 466 60.25 50.00 3.00 2.00
Reverse primer GTAGTACCGGCGCGAAATCT Minus 20 1153 1134 60.25 55.00 5.00 2.00
Product length 707

Primer pair 21

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer TCTACTGGGGCAATGAAGCC Plus 20 543 562 59.74 55.00 3.00 1.00
Reverse primer AGTCGTTGCTCCACTTCGTC Minus 20 950 931 60.32 55.00 3.00 1.00
Product length 408

Primer pair 22

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer ATGGGGTTCAAGACCTTCGG Plus 20 479 498 59.67 55.00 4.00 1.00
Reverse primer TTCATTGCCCCAGTAGACGG Minus 20 559 540 59.75 55.00 3.00 2.00
Product length 81

Primer pair 23

Sequence (5'->3') Template strand Length Start Stop Tm GC% Self complementarity Self 3' complementarity
Forward primer ACGCGAGGATGTCTATGAGC Plus 20 511 530 59.69 55.00 4.00 2.00
Reverse primer AAGCGGTCCAGGTTCATCAC Minus 20 2169 2150 60.32 55.00 3.00 0.00
Product length 1659
Add a comment
Know the answer?
Add Answer to:
What is the sequence of the first forward primer sequence that you obtain? (You can copy...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 8. Design appropriate PCR primers for the human DDX3X gene. Give their sequences below and explain...

    8. Design appropriate PCR primers for the human DDX3X gene. Give their sequences below and explain how you designed them (20 points, 10 each). The DDX3X cDNA sequence from the NCBI database is provided to you on Moodle Within the sequence, first identify the coding sequence (cds) as this is the region you want to amplify by PCR Hint: It tells you on the first page of the sequence file where the cds is positioned! Also remember that a cds...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT