Question

8. (4 points) Suppose that there is a frameshift mutation between the 10th and 11th base (counting from the left: a Guanine is added) in the minus strand of DNA, finish the table giving the resulting peptide. Circle the changes in the resulting peptide caused by the mutation. What is the importance of these changes. (Assume the reading frame starts with the first codon) Minus strand of DNA 3 TACC TACTTccCGCAACT 5 Positive strand of DNA. mRNA (codons) Amino acids tRNA

0 0
Add a comment Improve this question Transcribed image text
Answer #1

TABLE 1: NORMAL STRAND

(Non coding strand) MINUS STRAND: 3' TAC CTA CTT ccC GCA ACT 5'

(coding strand )Positive strand: : 5' ATG GAT GAA GGG CGT TGA 5'

m RNA (CODONS): 5' AUG GAU GAA GGG CGU UGA 3'

Amino Acids: Met-Asp-Glu-Gly-Arg

tRNA: 5 required (No tRNA for UGA)

TABLE 2: MUTATED STRAND

Mutated Minus strand: 3' TAC CTA CTT CGC CGC AAC T 5'

Mutated Positive strand: 5' ATG GAT GAA GCG GCG TTG A3'

mRNA (Codons): 5' AUG GAU GAA GCG GCG UUG A5'

Amino Acids:Met-Asp-Glu-Ala-Ala-Leu

tRNA:6 required(Stop codon missing)

Add a comment
Know the answer?
Add Answer to:
Suppose that there is a frameshift mutation between the 10^th and 11^th base (counting from the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • 1) Which of the following mutations could result in a frameshift? A) a base insertion B)...

    1) Which of the following mutations could result in a frameshift? A) a base insertion B) a base deletion C) a base substitution D) either A or B E) A, B, and C 2) Which of the following point mutations would be most likely to result in a non-functioning protein? A) a single base substitution in an intron B) a single base deletion near the end of the coding sequence C) a single base deletion in the codon following the...

  • please andwer all the questions 7) Describe at least two major intramolecular forces that help stabilize...

    please andwer all the questions 7) Describe at least two major intramolecular forces that help stabilize the DNA double-helix? 8) In mammalian female cells, the DNA of the Barr Body is characteristic of: a) Heterochromatin b) Euchromatin c) Dispersed chromatin d) Patemal DNA ONLY e) Maternal DNA ONLY 9) When used to describe the RNA polymerases' activity, the term “processivity” refers to: a) The ability to recognize and bind to a promoter region b) The ability to remain attached to...

  • Please help me with biology 1. Online exercise: Find reports that document the relationship between the...

    Please help me with biology 1. Online exercise: Find reports that document the relationship between the age of the mother and the risk for having a baby with Down Syndrome (Trisomy 21). For your interest only 2. Suppose that during transcription of a gene, RNA polymerase mistakenly inserts an incorrect base opposite the template DNA. This error results in an mRNA with an altered nucleotide sequence. Is this a mutation? For questions 3-10, consider the following mRNA, which is the...

  • Week 14- Chapter 21 Homework Problem 21.72 < 52 of 58 Review Constants| Periodic Table Part A How does a point mutation for an enzyme affect the order of amino acids in that protein? Drag the term...

    Week 14- Chapter 21 Homework Problem 21.72 < 52 of 58 Review Constants| Periodic Table Part A How does a point mutation for an enzyme affect the order of amino acids in that protein? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help then the order of amino acids will change in the of the polypeptide chain If the resulting codon still codes for the same amino acid, If the...

  • answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase...

    answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT