
answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase...
please andwer all the questions
7) Describe at least two major intramolecular forces that help stabilize the DNA double-helix? 8) In mammalian female cells, the DNA of the Barr Body is characteristic of: a) Heterochromatin b) Euchromatin c) Dispersed chromatin d) Patemal DNA ONLY e) Maternal DNA ONLY 9) When used to describe the RNA polymerases' activity, the term “processivity” refers to: a) The ability to recognize and bind to a promoter region b) The ability to remain attached to...
answer all the questions please
*3 2 1 OA- АаВЬСcl AaBbc | АаВЬСc| АаВЬС Emphasis Heading 1 1 Normal Strong Paragraph ly Styles 8) In mammalian female cells, the DNA of the Barr Body is characteristic of a) Heterochromatin b) Euchromatin c) Dispersed chromatin d) Paternal DNA ONLY e) Maternal DNA ONLY 9) When used to describe the RNA polymerases' activity, the term "processivity” refers to: a) The ability to recognize and bind to a promoter region b) The ability...
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
1. In assembling a nucleosome, normally the …(1) histone dimers first combine to form a tetramer, which then further combines with two … (2) histone dimers to form the octamer. A. 1: H1–H3; 2: H2A–H2B B. 1: H3–H4; 2: H2A–H2B C. 1: H2A–H2B; 2: H1–H3 D. 1: H2A–H2B; 2: H3–H4 E. 1: H1–H2; 2: H3–H4 2. There has been a mutation on several enzymes important in DNA replication. For each enzyme, discuss what the protein normally does and how the...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic RNA usually undergoes nuclear processing C. Polypeptides are synthesized by addition of amino acids to the amino terminus. D. The 3' end of mRNA corresponds to the carboxyl terminus of the protein. Grade 2. Which of the following A. It may be autocatalytic. B. Spliceosomes are present in organelles and nuclei C. It involves removal of exons is true regarding RNA processing? D. It...
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....
13) The number of new mutations in a given gene per cell generation is called? B) mutation rate C) recombination frequeney 14) A type of spontaneous mutation that occur when a purine base is removed from the DNA is A) deamination D) alkylate bases В) apurination E) base analog C) thymine dimers 15) A type of spontaneous mutation that involves a temporary change in the base conformation because the keto group may change to an enol functional group or amino...
In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase to pause, facilitating termination. rho binds the mRNA, and when it makes contact with RNA polymerase, it assists with the removal of the mRNA from the DNA template. the rho factor binds to the -10 consensus sequence located in the promoter region to terminate transcription. a site within the poly(A) tail is cleaved which signals termination. the 3' untranslated region (3" UTR) is synthesized....
Choose all that apply to the initiation of transcription Promoter segments Ribosome tRNA DNA polymerase Transcription factors Question 25 (4 points) Saved Choose all the molecules that are used in transcription: a) primase b) DNA c) nucleotides d) RNA polymerase e) SSB (single strand binding protein)