Question

4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical (except for Us instead of Ts) to the non-template strand. Explain. d. Define promoter strength e. Predict the effect of the following mutations on the strength of this promoter (stronger, weaker, no change). The changes indicated show the sequence as top strand/complementary strand. 1) Replacement of CTT/GAA at -23 to -20 with AAG/TTC 2) Replacement of G/C at -9 with A/T 3) Replacement of T/A at-12 with C/G 4) Replacement of G/C at -38 with C/G 5) Insertion of AT/TA between -18 and-17

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Please find the answers below:

Answer a: The -10 to -35 bp long sequences in the DNA just prior to the transcription start site are called the upstream promoter region which comprise the TATA box and poly-U region. These regions are identified by the RNA polymerase and then only transcription starts.

Answer b: The spacing between -10 to -35 represents the consensus and conserved sequences of the upstream regions of the gene. These sequenes are similar in all the oranisms and are identified by the RNA polymerase before binding to the transcription start site.

Answer c: True. Although DNA and RNA are both nucleic acids in nature, there are two basic differences between them. Whereas the DNA contains deoxyribose sugar, RNA contains the ribose sugars. Further, one of the nitrogenous bases in the DNA is thymine whereas the RNA contains uracil as its counterpart. Thus, every transcribed sequence of the mRNA contains an uracil instead of thymine.

Answer d: Promoter strength is defined as the degree of consensus it follows with respect to other promoter regions so that the RNA polymerase could easily identify it and bind strongly. The more easily a promoter is bound by RNA polymerase, the higher is the intensity of gene expression. Such promoters are called strong promoters and often utilized in DNA recombinant technology.

Add a comment
Know the answer?
Add Answer to:
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The gene in the diagram is transcribed by RNA polymerase from left to right. If the...

    The gene in the diagram is transcribed by RNA polymerase from left to right. If the primary transcript in the diagram has the sequence 5' AAAAGGGGGGAUGGGG...3, the DNA strand with the sequence 5' AAAAGGGGGGATGGGG....3' would be found in the DNA strand labeled transcribed region promoter W exon intron exorn primary transcriptS

  • Sigma-70 allows E. coli RNA polymerase to recognize: A. a -12 and -35 region upstream of...

    Sigma-70 allows E. coli RNA polymerase to recognize: A. a -12 and -35 region upstream of the transcribed region of a gene B. a -12 and -24 region upstream of the transcribed region of a gene C. a -10 and -35 region upstream of the transcribed region of a gene D. a -10 and -35 region downstream of the transcribed region of a gene E. a -24 and -35 region upstream of the coding region of a gene

  • Which of the following is (are) characteristic of rho-independent termination of RNA transcription in E. coli?...

    Which of the following is (are) characteristic of rho-independent termination of RNA transcription in E. coli? A) The 3' end of the RNA transcript contains self-complementary inverted sequences that form a hairpin. B) The DNA sequence that encodes the 3”end of the RNA transcript contains a polyA repeat sequence in the coding strand. C) The DNA sequence that encodes the 3”end of the RNA transcript contains a polyT repeat sequence in the coding strand. D) Both A and C.

  • answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase...

    answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...

  • In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase...

    In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase to pause, facilitating termination. rho binds the mRNA, and when it makes contact with RNA polymerase, it assists with the removal of the mRNA from the DNA template. the rho factor binds to the -10 consensus sequence located in the promoter region to terminate transcription. a site within the poly(A) tail is cleaved which signals termination. the 3' untranslated region (3" UTR) is synthesized....

  • Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic...

    Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic RNA usually undergoes nuclear processing C. Polypeptides are synthesized by addition of amino acids to the amino terminus. D. The 3' end of mRNA corresponds to the carboxyl terminus of the protein. Grade 2. Which of the following A. It may be autocatalytic. B. Spliceosomes are present in organelles and nuclei C. It involves removal of exons is true regarding RNA processing? D. It...

  • please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...

    please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...

  • 1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...

    1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...

  • can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized...

    can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....

  • Compare the strength of the following promoters for the sigma 70 RNA Polymerase subunit:                 ...

    Compare the strength of the following promoters for the sigma 70 RNA Polymerase subunit:                  -35                            -10                             +1          1.            TTGACA                    TATAAT                    A          2.            CGTACC                    TTTAAA                    G          3.            TTCACC                    TCTAAT                     A          4.            ATGACC                   TACAAT                    C          5.            TAGAAC                   AATATT                    A Arrange the numbers for the promoters from strongest to weakest.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT