Question

Which of the following is (are) characteristic of rho-independent termination of RNA transcription in E. coli?...

Which of the following is (are) characteristic of rho-independent termination of RNA transcription in E. coli?

A) The 3' end of the RNA transcript contains self-complementary inverted sequences that form a hairpin.

B) The DNA sequence that encodes the 3”end of the RNA transcript contains a polyA repeat sequence in the coding strand.

C) The DNA sequence that encodes the 3”end of the RNA transcript contains a polyT repeat sequence in the coding strand.

D) Both A and C.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. which of the following are/is characterstic of rho-independent tremination of RNA transcription in E-coli?

a) The 3'end of the RNA trancript contains self complementary inverted sequences that form a hairpin.

b) The DNA sequence that encodes the 3'end of the RNA transcript contains a polyA repeat sequence in the coding strand.

c) The DNA sequnce that encodes the 3' end of the rna transcript contains poly repeat sequence in the coding strand.

d) Both A and C.

Answer:

The DNA sequence that encodes the 3'prime end of the RNA transcript contains a polyA repeat sequence in the coding strand.

Explanation:

Rho independent transcription otherwise called intrinsic transcription occurs without the help of rho protein. rho protein is a hexameric protein with helicase activity. rho independent transcription occurs when there is a polyA tail present at 3'prime end in the template. The newly produced Mrna strand has uracil at 3'end formed as a result of complementary base pairing with Adenine rich region in the template strand. The uracil-Adenine bonding is the weakest and unstable bonding that results in unwinding of hairpin structure and dissociation of RNA polymerase resulting in termination of transcription.

Add a comment
Know the answer?
Add Answer to:
Which of the following is (are) characteristic of rho-independent termination of RNA transcription in E. coli?...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Transcription is terminated, when a characteristic RNA structure _____ is formed by local RNA palindromic sequences...

    Transcription is terminated, when a characteristic RNA structure _____ is formed by local RNA palindromic sequences at the 3’- end. The structure interacts with RNAP-bound NusA, causing dissociation of RNAP from template DNA. The RNAP dissociation is stimulated by sequence-specific binding of _____ proteins to the transcribed RNA, enhancing termination of transcription. Select one: a. hairpin ;;;; rho b. hairpin ;;;; sigma c. beta-turn ;;;; rho d. beta-turn ;;;; sigma e. None of these

  • 34. Transcription is terminated, when a characteristic RNA structure is formed by local RNA palindromic sequences...

    34. Transcription is terminated, when a characteristic RNA structure is formed by local RNA palindromic sequences at the 3-end. The structure interacts with RNAP-bound NusA, causing dissociation of RNAP from template DNA. The RNAP dissociation is stimulated by sequence specific binding of proteins to the transcribed RNA, enhancing termination of transcription Select one a. hairpin - rho b. hairpin sigma c. beta-turn rho d. beta-turn sigma e. None of these

  • In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase...

    In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase to pause, facilitating termination. rho binds the mRNA, and when it makes contact with RNA polymerase, it assists with the removal of the mRNA from the DNA template. the rho factor binds to the -10 consensus sequence located in the promoter region to terminate transcription. a site within the poly(A) tail is cleaved which signals termination. the 3' untranslated region (3" UTR) is synthesized....

  • Termination of transcription in both E. coli and eukaryotic cells occurs because a.) there is a...

    Termination of transcription in both E. coli and eukaryotic cells occurs because a.) there is a termination signal in the DNA following the gene sequence. b.) there is a hairpin structure followed by a string of U

  • Termination of transcription in both E. coli and eukaryotic cells occurs because a.) there is a...

    Termination of transcription in both E. coli and eukaryotic cells occurs because a.) there is a termination signal in the DNA following the gene sequence. b.) there is a hairpin structure followed by a string of U

  • Which of the following is true for transcription in E. coli, but not for transcription in...

    Which of the following is true for transcription in E. coli, but not for transcription in humans? a. Transcription requires RNA polymerase to add nucleoside triphosphates to the 3' end of the growing transcript (RNA). b. Transcription does not require primers during initiation or elongation. c. Transcription requires promoters, which have mostly adenines and thymines. d. Transcription produces polycistronic mRNA that includes several coding regions within one transcription unit.

  • Which of the following is a chemical or structural characteristic of RNA? The RNA sugar is...

    Which of the following is a chemical or structural characteristic of RNA? The RNA sugar is ribose, which has an OH group on the 2' carbon. O RNA is usually a single-stranded molecule. The bases in RNA include uracil instead of thymine. RNA molecules are generally shorter in length compared DNA macromolecules. All of the above are either a chemical or structural characteristic of RNA. Which of these sequences could form a hairpin? 5' GGGGTTTTCCCC 3' 5' AAAAAAAAAAAA 3' 5'...

  • 4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...

    4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...

  • The schematic illustrates steps in RNA processing. The DNA strand is shown in red and yellow,...

    The schematic illustrates steps in RNA processing. The DNA strand is shown in red and yellow, and the RNA strand is shown in green and blue. The steps in RNA processing are labeled 1-3, and the components of the RNA transcript are labeled A-C. Steps in RNA processing are indicated below in alphabetical order, select the step number to put these processes in chronological order. If the indicated step does not occur, select 'This process does not happen'. removal of...

  • 3. Two RNA sequences that can cause premature transcription termination are the trp leader sequence (trp...

    3. Two RNA sequences that can cause premature transcription termination are the trp leader sequence (trp L) in E. coli and the thi riboswitch in B. subtilis. For each of these RNAs, discuss how alternate secondary structures impact termination and describe the conditions that favor each of the alternate secondary structures.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT