Sigma-70 allows E. coli RNA polymerase to recognize: A. a -12 and -35 region upstream of...
Sigma-70 allows E. coli RNA polymerase to recognize:
- A. a -12 and -35 region upstream of the transcribed region of a gene
- B. a -12 and -24 region upstream of the transcribed region of a gene
- C. a -10 and -35 region upstream of the transcribed region of a gene
- D. a -10 and -35 region downstream of the transcribed region of a gene
- E. a -24 and -35 region upstream of the coding region of a gene
Homework Answers
Answer is C
Sigma 70 RNA polymerase of E.coli recognize upstream region of -10 to -35 of transcribing genes and bind with it for further RNA synthesis.
Add Answer to:
Sigma-70 allows E. coli RNA polymerase to recognize:
A. a -12 and -35 region upstream of...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Why does E. coli have several different sigma factors? A.They allow RNA polymerase I, RNA polymerase...
Why does E. coli have several different sigma factors? A.They allow RNA polymerase I, RNA polymerase II and RNA polymerase III to bind to different promoters. B.They allow the different subunits of the RNA polymerase holoenzyme to bind to each other. C.They are redundant in case one is mutated. They all perform the same function. D.One is needed to transcribe mRNA. A second is needed to transcribe tRNA. And a third is needed to transcribe rRNA. E.They are used if...
Compare the strength of the following promoters for the sigma 70 RNA Polymerase subunit: ...
Compare the strength of the following promoters for the sigma 70 RNA Polymerase subunit: -35 -10 +1 1. TTGACA TATAAT A 2. CGTACC TTTAAA G 3. TTCACC TCTAAT A 4. ATGACC TACAAT C 5. TAGAAC AATATT A Arrange the numbers for the promoters from strongest to weakest.
which region(s), A, B, and/or C, would be transcribed into an RNA transcript Which region(s), A,...
which region(s), A, B, and/or C, would be transcribed into an
RNA transcript
Which region(s), A, B, and/or C, would be transcribed into an RNA transcript? Upstream Downstream DNA ОА O A and B A, B and C Ов
Part A The sigma (?) subunit binds to the core RNA polymerase enzyme. The function of...
Part
A
The sigma (?) subunit binds to the core RNA polymerase
enzyme. The function of this sigma factor is to recognize and bind
to the promoter of a gene so that transcription can be initiated.
The closeup shows the secondary structure of the sigma (?)
subunit, which consists of four domains. Identify the domains
labeled 1-3.
The sigma (?) subunit binds to the core RNA polymerase
enzyme. The function of this sigma factor is to recognize and bind
to...
The following elements are needed for transcription to initiate in E. coli: a) an origin and...
The following elements are needed for transcription to initiate in E. coli: a) an origin and RNA polymerase b) initiator protein and a promoter c) the sigma subunit of RNA polymerase and an RNA template d) RNA polymerase and a promoter
can you guys please give me the correct answers and explain why? 12. Which of the...
can you guys please give me the correct answers and explain
why?
12. Which of the following statements concerning histones is INCORRECT? A. The N-terminal tails of histone proteins are frequently post-translationally modified B. Histones are small, basic proteins. C. Histones bind DNA via hydrogen bonding with bases in the major groove. D. Histone HI is not one of the core histones. E. Histones are present in eukaryotes but not bacteria. V 13. You are studying two E coli genes...
Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter ....
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
Incorrect Question 7 Which region(s), A, B, and/or C, would be transcribed into an RNA transcript?...
Incorrect Question 7 Which region(s), A, B, and/or C, would be transcribed into an RNA transcript? Upstream Downstream в с DNA A and B A B and Incorrect Question 8 MacBook Air
6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what n...
6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what name is given to a cluster of genes with related functions, along with their control 26) A) exon B) operon C) promoter D) activator E) regulatory gene A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
which region(s), A, B, and/or C, would be transcribed into an
RNA transcript
Which region(s), A, B, and/or C, would be transcribed into an RNA transcript? Upstream Downstream DNA ОА O A and B A, B and C Ов
Part
A
The sigma (?) subunit binds to the core RNA polymerase
enzyme. The function of this sigma factor is to recognize and bind
to the promoter of a gene so that transcription can be initiated.
The closeup shows the secondary structure of the sigma (?)
subunit, which consists of four domains. Identify the domains
labeled 1-3.
The sigma (?) subunit binds to the core RNA polymerase
enzyme. The function of this sigma factor is to recognize and bind
to...
can you guys please give me the correct answers and explain
why?
12. Which of the following statements concerning histones is INCORRECT? A. The N-terminal tails of histone proteins are frequently post-translationally modified B. Histones are small, basic proteins. C. Histones bind DNA via hydrogen bonding with bases in the major groove. D. Histone HI is not one of the core histones. E. Histones are present in eukaryotes but not bacteria. V 13. You are studying two E coli genes...
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
Incorrect Question 7 Which region(s), A, B, and/or C, would be transcribed into an RNA transcript? Upstream Downstream в с DNA A and B A B and Incorrect Question 8 MacBook Air
6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what name is given to a cluster of genes with related functions, along with their control 26) A) exon B) operon C) promoter D) activator E) regulatory gene A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago