Question
which region(s), A, B, and/or C, would be transcribed into an RNA transcript

Which region(s), A, B, and/or C, would be transcribed into an RNA transcript? Upstream Downstream DNA ОА O A and B A, B and C
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Upstream + + Downstream Nontemplate strand Promoter RNA-coding region DNA, ATGGGTGACTCGCTAAAGCTCGATACGCTATAG VW Terminator TeOn reference to the above image, regions B and C would be transcribed into an RNA transcript. Incase if both the options cannot be marked at the same time, region B would be most appropriate one.

Add a comment
Know the answer?
Add Answer to:
which region(s), A, B, and/or C, would be transcribed into an RNA transcript Which region(s), A,...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Incorrect Question 7 Which region(s), A, B, and/or C, would be transcribed into an RNA transcript?...

    Incorrect Question 7 Which region(s), A, B, and/or C, would be transcribed into an RNA transcript? Upstream Downstream в с DNA A and B A B and Incorrect Question 8 MacBook Air

  • Sigma-70 allows E. coli RNA polymerase to recognize: A. a -12 and -35 region upstream of...

    Sigma-70 allows E. coli RNA polymerase to recognize: A. a -12 and -35 region upstream of the transcribed region of a gene B. a -12 and -24 region upstream of the transcribed region of a gene C. a -10 and -35 region upstream of the transcribed region of a gene D. a -10 and -35 region downstream of the transcribed region of a gene E. a -24 and -35 region upstream of the coding region of a gene

  • The gene in the diagram is transcribed by RNA polymerase from left to right. If the...

    The gene in the diagram is transcribed by RNA polymerase from left to right. If the primary transcript in the diagram has the sequence 5' AAAAGGGGGGAUGGGG...3, the DNA strand with the sequence 5' AAAAGGGGGGATGGGG....3' would be found in the DNA strand labeled transcribed region promoter W exon intron exorn primary transcriptS

  • Can someone please help with these two questions? Thank you. 4. Here is an RNA transcript...

    Can someone please help with these two questions? Thank you. 4. Here is an RNA transcript freshly transcribed from a gene. It is immature, meaning that it has not been processed yet into a mature mRNA. a) If you could zoom in on this molecule, what two things would you observe at the molecular level that would indicate to you that it is RNA and not DNA? b) Which end of the molecule was the last bit to be transcribed,...

  • Question 7 1 pts What would be the RNA transcript if in the below illustration the...

    Question 7 1 pts What would be the RNA transcript if in the below illustration the HP loop terminator was lost by mutation? No transcript Both A and B O A only O Bonly O Part of A, none of B

  • The functions of the cap on mRNA include___. A Translational start identification B RNA transcript protection...

    The functions of the cap on mRNA include___. A Translational start identification B RNA transcript protection from degradation and identification of translation start site C RNA transcript protection from degradation D addition of the poly A tail splicing The following are needed for proteins to be degraded___ A proteosomes and ubiquitination B proteosome C ubiquitination D heat shock proteins If you have done the following technique where you had a specific DNA sequence by itself or that same sequence with...

  • 1. How can antisense RNA inhibit translation? a.An antisense RNA makes a protein that inhibits translation....

    1. How can antisense RNA inhibit translation? a.An antisense RNA makes a protein that inhibits translation. b.An antisense RNA binds to a transcript and inhibits translation. c.An antisense RNA forms a single stranded structure that inhibits translation. d.An antisense RNA binds to a translation inhibitor protein and prevents translation. 2. which of the following is true with regards to enhancer sequences? a.represor proteins bind to them b. they may be located eiter upstream or downstream of the promoter c.they are...

  • allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final...

    allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final mRNA product. Which of the following modifications is something that occurs to eukaryotic RNA (which one is correct): OA) removing exons from the transcript B) adding introns into the transcript C) adding a poly(A) tail to the transcript by poly(A) polymerase OD) adding start codons to the transcript after its synthesis E) removing a 5' cap from the transcript Question 18 (1 point) Origins,...

  • Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides...

    Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: O addition of the poly A tail O removal of exons O splicing O addition of the 5' cap Question 7 (1 point) Which of the following recognizes the promoter region of a gene in E. coli allowing RNA polymerase...

  • In these imprinted cells, the SNRPN transcript overlaps with another gene, called UBE3A, which is transcribed...

    In these imprinted cells, the SNRPN transcript overlaps with another gene, called UBE3A, which is transcribed in the opposite direction. This means that the region that the RNA polymerase transcribes in these two genes actually overlaps; in some cases, overlapping transcription in opposite directions leads to transcriptional interference, meaning that collisions between the polymerases traveling in opposite directions can interfere with transcription. It is believed that this takes place in this case, meaning that the more SNRPN transcription occurs, the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT