Can someone please help with these two questions? Thank you.4.
a.
b.
c.
Pre-mRNA:
5’ TGAGACTGTTGACCGCGATTTATATGCATGTGAT( Transcription start site-+1)
AGGAAAUGAAAUGCCA-gaauugccggaugac-GGUCAGC-aaucga-GCACAUUUGUGAUUUACCGU-3’
Exon 1 Intron 1 Exon 2 Intron2 Exon 3
d.
Mature-mRNA:
5’ CH3-AGGAA-AUG(start codon)AAAUGCCAGGUCAGCGCACAUUUGUGA(Stop)UUUACCGU-3’AAAAAA
Cap 5’UTR 3’UTR Poly A tail
5.
· For translation, mRNA moves to the cytoplasm, where it is subjected to constant degradation. Thus, Post-transcriptional processing of mRNA is essential.
· The half-life depends on the stability of the mRNA, that in turn is determined by capping (methylation) at 5’ end and poly A tail (polyadenylation) at 3’ end.
· Many eukaryotic gene contain, regions of “expressed sequence” or exons, which code for proteins and non-coding or” intervening sequence” or introns.
· The pre-RNA transcript requires splicing process, by which introns are removed, exons are joined to form mature RNA. The process of splicing is mediated by small nuclear ribonuclear proteins (snRNPs or SNURPS).
· Thus, the mRNA obtained by transcription is the pre-mRNA, which is converted to mature RNA by RNA processing.
· The proteins interact specifically with snRNA or small nuclear RNA for pre-mRNA processing.
· snRNA has specific sequences, based on which they are designated as U1 to U6.
· The U1 snRNA help in initiation of RNA processing.
· They can base pair with the pre-mRNA and protect it from adenylation or cleavage.
· They also form recognition point for 5’ capping point.
The proteins form a loop with intron forming a complex calle splicosome.
The exons are brought side by side. Introns is cleaved and exons are attached.

Can someone please help with these two questions? Thank you. 4. Here is an RNA transcript...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
5. A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5ʹ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA encoded by this mutant gene would be spliced. Indicate which introns and exons would be found in the mRNA after splicing occurs
Hint 1. How is a complete initiation complex formed? Drag the labels to their correct locations in the diagram to describe the roles of the various transcription factors in the formation of a complete initiation complex Reset Help part of initial committed complex TFIIA IIB added during formation of minimal initiation complex sa cosci.ccccccca RNA polymerase II added during formation of complete initiation complex Submit Request Answer Hint 2. How is pre-mRNA processed into mature mRNA? Select the two statements...
B. (10pts) Gene expression can be regulated in many ways. In the gene below, each letter represents a different mutation. Indicate which mutation would: (Use each letter only once.) trigger non-sense mediated decay increase transcript stability result in aberrant splicing reduce mRNA expression levels alter ADAR RNA editing promoter D — transcribed region intron A intron E exon- transcription factor binding sites exon spliced mRNA T 5'UTR CDS 3'UTR start codon stop codon C. (8pts) UAU encodes the amino acid...
A eukaryotic protein-encoding gene has three introns and 4 exons. A splicing repressor commonly binds to the 3' end of the second intron (introns 2/ exon three splice sites) draw the mRNA strand before and after splicing Diagram a final functional eukaryotic mRNA molecule from the 5' end to 3' end. There should be 7 items labeled in the diagram.
Carvas X CO Inactivation of a specific transcription factor Modifications to the RNA transcript OPresence of repressor protelns to reduce transcription Question 8 10pts The following lists many forms in which gene expression ls regulated in Eukaryotes. Which of those is common to both prokaryotes and eukaryotes? Tight colling of the DNA around histone proteins, making it inaccessible to RNA polymerase Protecting the mRNA by adding a 5 G-cap and 3 poly A tal O Repulating the availablity of transcription...
QUESTION 1 Which of the following statements regarding splicing is FALSE? A) The length of introns determines the efficiency of splicing. B) Many human neurological disorders are caused by splicing errors and/or mutations in splicing factors. C) Splicing requires the action of a variety of snRNAs that direct the transesterification reactions. D) Splicing is dictated by sequence features in pre-mRNA transcripts QUESTION 2 Which of the following mRNA processing factors does NOT associate with...
Need help with biochemistry please
3. RNA splicing. Eukaryotic mRNAs are frequently spliced before they are translated. Algae have the smallest known intron. The sequence of the algal pre-mRNA before splicing occurs is shown below. exon 1 intron exon 2 5-AUGGAAAUUAAGUACUAUAUUGAAUUUCAGGUUGAAGAUUUAGGAAUGG-3' A) What is the sequence of the mature mRNA after splicing occurs? 5'- -3' B) What is the sequence of the polypeptide after translation occurs? (N-terminus) (C-terminus) C) Identify the type of mutation in the following mutant pre-mRNAs. [In...
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
please help with this genetics question! i really need
help
1. Diagram a eukaryotic gene containing three exons and two introns. Your diagram should show DNA and the mature mRNA molecules. Show the following (if it exists in the DNA indicate so, if it exists in the mature mRNA, indicate so): a. AG and GU dinucleotides corresponding to intron-exon junctions b. +1 TSS C. 5' and 3' UTRS d. the start codon sequence e. the stop codon sequence f. the...