5. A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5ʹ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA encoded by this mutant gene would be spliced. Indicate which introns and exons would be found in the mRNA after splicing occurs
In eukaryotes Introns and Exons are present on the genes.Introns are intervening sequences and do not code for proteins where as exons are expressed sequences that code for proteins.One or more Introns are removed during the translation process and the remaining exon sequences code for proteins.The removed exons are degraded rapidly by RNAses and the components are reused by the cell.
5'
| Exon-1 | Intron-1 | EXon-2 | Intron-2 | Exon-3 |
deletion mutation at exon2 and intron2
5'
| Exon-1 | Intron-1 | Exon-3 |
5. A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon...
A eukaryotic protein-encoding gene has three introns and 4 exons. A splicing repressor commonly binds to the 3' end of the second intron (introns 2/ exon three splice sites) draw the mRNA strand before and after splicing Diagram a final functional eukaryotic mRNA molecule from the 5' end to 3' end. There should be 7 items labeled in the diagram.
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
The human protein coding gene frt has three exons. A mutation at the splice junction between the second exon and first intron leads to an inability to remove a DNA segment during splicing. Which of the following is describes the most likely outcome(s) of this mutation: termination of translation within the coding sequence of the second exon termination of transcription within the coding sequence of the second intron termination of transcription before the coding sequence of the second exon termination...
The human protein coding gene frt has three exons. A mutation at the splice junction between the second exon and first intron leads to an inability to remove a DNA segment during splicing. Which of the following is describes the most likely outcome(s) of this mutation: O termination of transcription within the coding sequence of the second intron O termination of transcription before the coding sequence of the second exon termination of translation within the coding sequence of the second...
why is E the answer
Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass transmembrane protein. Shown are the transcriptional start site, splice donor, acceptor and branch sites and translational start and stop codons. Transcriptional start EXON 1 INTRON 1 EXON 2 INTRON 2 EXON 3 Spfice Donor Splice Acceptor Polyadenylation signal Branch point 17. Treatment with ethidium bromide, an intercalating agent, caused DNA polymerase to add an extra...
Need help with biochemistry please
3. RNA splicing. Eukaryotic mRNAs are frequently spliced before they are translated. Algae have the smallest known intron. The sequence of the algal pre-mRNA before splicing occurs is shown below. exon 1 intron exon 2 5-AUGGAAAUUAAGUACUAUAUUGAAUUUCAGGUUGAAGAUUUAGGAAUGG-3' A) What is the sequence of the mature mRNA after splicing occurs? 5'- -3' B) What is the sequence of the polypeptide after translation occurs? (N-terminus) (C-terminus) C) Identify the type of mutation in the following mutant pre-mRNAs. [In...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site +1 Promoter - as much detail as you can Gene start ATG and stop codons Transcription Regulatory Sequences such as activators/repressors and enhancers/insulators Draw features of importance at the pre-mRNA level Designate Introns and Exons Designate important Sequences to direct and regulate splicing three important sequences for the chemistry of splicing splicing regulatory sequences (ISS, ISE, ESE, ESS) Modifications at level of pre-mRNA UTRs,...
A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56 amino acids, and the other has 82 amino acids. Which of the statements are possible explanations for how the same gene can encode both of these proteins? 1-The same gene encodes both proteins by using different combinations of introns in the pre‑mRNA via alternative splicing. 2-The same gene encodes both proteins by generating a poly(A) tail on the pre‑mRNA. 3-The same gene encodes...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...