The following elements are needed for transcription to initiate in E. coli: a) an origin and...
The following elements are needed for transcription to initiate in E. coli:
a) an origin and RNA polymerase
b) initiator protein and a promoter
c) the sigma subunit of RNA polymerase and an RNA template
d) RNA polymerase and a promoter
Homework Answers
Right answer is d) RNA polymerase and promoter.
The promoter is the sequence on DNA on which RNA polymerase binds. Now this RNA polymerase leads to transcribe the DNA strand which is template strand by the process of transcription. The mRNA is produced from the template strand via the rule of complementarity. The A, T, G and C nucelotides are complementary with U, A, C and G nucelotides respectively.
Add Answer to:
The following elements are needed for transcription to initiate
in E. coli:
a) an origin and...
The rate of transcription of a gene in E. coli would likely not be directly affected...
The rate of transcription of a gene in E. coli would likely not be directly affected by: a. the promoter b. a mutation in RNA polymerase c. the size of the polysome d. Actinomycin D
#1 Match the protein to it's function in transcription: RNA polymerase III, Transcription Factor IID, Transcription...
#1 Match the protein to it's function in transcription: RNA polymerase III, Transcription Factor IID, Transcription Factor IIE, Sigma Factor, Transcription Factor IIH, RNA polymerase II, Helicase, RNA polymerase II •Transcribes tRNA •Recognizes promoter region in bacteria •Transcribes mRNA •Recognizes promoter region in eukaryote •Exposes a single stranded DNA template
Which subunit of RNA polymerase is absolutely required to initiate transcription? O O OOO Answers A-D...
Which subunit of RNA polymerase is absolutely required to initiate transcription? O O OOO Answers A-D A Alpha B Sigma c Omega D Beta 8 OF 12 QUESTIONS VERSION 3.8.1 Previous Next
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core...
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....
Which of the following is true for transcription in E. coli, but not for transcription in...
Which of the following is true for transcription in E. coli, but not for transcription in humans? a. Transcription requires RNA polymerase to add nucleoside triphosphates to the 3' end of the growing transcript (RNA). b. Transcription does not require primers during initiation or elongation. c. Transcription requires promoters, which have mostly adenines and thymines. d. Transcription produces polycistronic mRNA that includes several coding regions within one transcription unit.
4. Answer the following concerning promoters and transcription. (15 points) a. What role do promoters play...
4. Answer the following concerning promoters and transcription. (15 points) a. What role do promoters play in transcription? b. What is the common structure of a bacterial promoter with respect to its consensus sequences? c. What is the role of the sigma subunit for bacterial RNA polymerase as it relates to promoters? d. Eukaryotic promoters are more variable than prokaryotic promoters. Explain why e. Explain what would happen to a eukaryotic promoter if it were associated with acetylated
Which of the following is NOT a function of transcription that requires the activity from subunits...
Which of the following is NOT a function of transcription that requires the activity from subunits of the Core RNA Palymerase? a. RNA polymerase activity that base-pairs and polymerizes nucleotides to make mRNA. b. Helicase activity that unwinds the double-stranded DNA molecule for transcription c. Specific recognition of -35 box and -10 box sites in the promoter region. d. General binding that helps RNA polymerase loosely adhere to DNA, before Transcription begins. Oe. Trick Question. The Core RNA polymerase can...
4. A protein that works with RNA polymerase in prokaryotes to initiate transcription (two words, no spaces)....
4. A protein that works with RNA polymerase in prokaryotes to initiate transcription (two words, no spaces). 5. Prokaryotic transcription and translation are events. 7. The DNA used as a template molecule during transcription is an molecule. 8. The leading strand of DNA is synthesized 9. The sequence of DNA found 35 base pairs upstream from the start of a gene in prokaryotes
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
Which subunit of RNA polymerase is absolutely required to initiate transcription? O O OOO Answers A-D A Alpha B Sigma c Omega D Beta 8 OF 12 QUESTIONS VERSION 3.8.1 Previous Next
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....
4. Answer the following concerning promoters and transcription. (15 points) a. What role do promoters play in transcription? b. What is the common structure of a bacterial promoter with respect to its consensus sequences? c. What is the role of the sigma subunit for bacterial RNA polymerase as it relates to promoters? d. Eukaryotic promoters are more variable than prokaryotic promoters. Explain why e. Explain what would happen to a eukaryotic promoter if it were associated with acetylated
Which of the following is NOT a function of transcription that requires the activity from subunits of the Core RNA Palymerase? a. RNA polymerase activity that base-pairs and polymerizes nucleotides to make mRNA. b. Helicase activity that unwinds the double-stranded DNA molecule for transcription c. Specific recognition of -35 box and -10 box sites in the promoter region. d. General binding that helps RNA polymerase loosely adhere to DNA, before Transcription begins. Oe. Trick Question. The Core RNA polymerase can...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago