The rate of transcription of a gene in E. coli would likely not be directly affected...
The rate of transcription of a gene in E. coli would likely not be directly affected by:
a. the promoter
b. a mutation in RNA polymerase
c. the size of the polysome
d. Actinomycin D
Homework Answers
Right answer is C) the size of the polysome.
Explanation:
Polysome is defined as the structure which is formed by RNA and ribosomes. When many ribosomes are attached to single RNA, then polysome is formed. The polysome is responsible for protein synthesis. That's why its size does not affect the transcription process.
Whereas promoter provides the binding site for RNA polymerase. Mutation in RNA polymerase leads to decrease the activity of RNA polymerase.
Actinomycin is a transcription inhibitor in E.coli. That's why a, b and d option affect the transcription process in E. Coli.
Please rate.
Add Answer to:
The rate of transcription of a gene in E. coli would likely not
be directly affected...
The following elements are needed for transcription to initiate in E. coli: a) an origin and...
The following elements are needed for transcription to initiate in E. coli: a) an origin and RNA polymerase b) initiator protein and a promoter c) the sigma subunit of RNA polymerase and an RNA template d) RNA polymerase and a promoter
Which of the following would be the consequence if the promoter of a gene has been...
Which of the following would be the consequence if the promoter of a gene has been mutated so that it is no longer recognized by a sigma factor? A. Nothing, RNA polymerase is still able to bind. B. Capping of transcripts would be affected in those specific genes. C. Transcription of many genes regulated by the same sigma factor would be disrupted. D. RNA polymerase would require priming in order to transcribe new messages. E. Transcription of only that gene...
Which of the following is true for transcription in E. coli, but not for transcription in...
Which of the following is true for transcription in E. coli, but not for transcription in humans? a. Transcription requires RNA polymerase to add nucleoside triphosphates to the 3' end of the growing transcript (RNA). b. Transcription does not require primers during initiation or elongation. c. Transcription requires promoters, which have mostly adenines and thymines. d. Transcription produces polycistronic mRNA that includes several coding regions within one transcription unit.
what would happen to transcription in e coli if the genes ending the rna polymerase beta...
what would happen to transcription in e coli if the genes ending the rna polymerase beta subunits were mutated
A cell that is heterozygous for a nonsense mutation in a tumor suppressor gene would most...
A cell that is heterozygous for a nonsense mutation in a tumor suppressor gene would most likely: A) Group of answer choices B) grow but not divide C) have a normal cell cycle D) arrest and induce apoptosis E) have a slightly increased cell cycle and increased cell growth F) grow and divide uncontrollably Which of the following correctly describes an event that occurs during transcription: Group of answer choices A) A DNA molecule is chemically modified to become a...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
The gene machine program shows you what happens when lactose is present in E. coli, and...
The gene machine program shows you what happens when lactose is present in E. coli, and how the lac operon is under negative control. However, the lac operon is also under positive control from a protein called CRP, eAMP Receptor Protein. The absence of the lac repressor is essential but not sufficient for effective transcription of the lac operon. RNA polymerase also depends on the presence of CRP. Like the lac repressor, which can bind to the DNA and lactose....
You have systematically mutagenized the lac operon in E. coli to produce a mutation that disrupts...
You have systematically mutagenized the lac operon in E. coli to produce a mutation that disrupts the function of each of the following elements: a. the promoter for LacI (P(I)) b. the LacI gene c. CRP binding site d. the promoter for the lac operon (P(lac)) e. the operator sequence f. a mutation in lacZ that disrupts the coding region but does not disrupt transcription g. a mutation in lacZ that blocks transcription For each of the above mutations, what...
Question 20 TFIID is a. a protein and a transcription factor. b. an enzyme. c. a...
Question 20 TFIID is a. a protein and a transcription factor. b. an enzyme. c. a promoter and a transcription factor. d. a promoter. e. part of the TATA box. Question 19 Without maintenance methyltransferase, the changes made by DNA methyltransferase would not a. be able to increase transcription of a gene. b. be passed on from one generation to the next c. coordinate regulation across different genes. d. produce microRNA. e. be able to decrease transcription of a gene....
2. a) Sketch a eukaryotic gene (brns) that is regulated by one transcription factor - Brt...
2. a) Sketch a eukaryotic gene (brns) that is regulated by one transcription factor - Brt - that bind 50 bps upstream of the transcription start site and an enhancer - Ned - that binds 10 kb upstream of the transcription start site. In your sketch, indicate the start of transcription, TATA box beginning of the open reading frame for your gene (ATG), location of the promoter, location of the transcription factors, location of the RNA polymerase II, location of...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
The gene machine program shows you what happens when lactose is present in E. coli, and how the lac operon is under negative control. However, the lac operon is also under positive control from a protein called CRP, eAMP Receptor Protein. The absence of the lac repressor is essential but not sufficient for effective transcription of the lac operon. RNA polymerase also depends on the presence of CRP. Like the lac repressor, which can bind to the DNA and lactose....
Question 20 TFIID is a. a protein and a transcription factor. b. an enzyme. c. a promoter and a transcription factor. d. a promoter. e. part of the TATA box. Question 19 Without maintenance methyltransferase, the changes made by DNA methyltransferase would not a. be able to increase transcription of a gene. b. be passed on from one generation to the next c. coordinate regulation across different genes. d. produce microRNA. e. be able to decrease transcription of a gene....
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago