Which of the following may render a silent mutation in an mRNA relevant? A) micro RNA B) SiRNA C) tRNA D) Pyrosequencing E) Random Mating
Silent mutation in tRNA is highly relevant: We know that there are different or specific tRNA molecule for each codon due to this codon usage bias may be affected due to which tRNA may not operate effectively. For example, specific tRNA molecule for the codon UCU and another specific for the codon UCC, both of which code for the amino acid serine. In this instance, if there was a thousand times less UCC tRNA than UCU tRNA, then the incorporation of serine into a polypeptide chain would happen a thousand times more slowly when a mutation causes the codon to change from UCU to UCC. If amino acid transport to the ribosome is delayed, translation will be carried out at a much slower rate. This can result in lower expression of a particular gene containing that silent mutation if the mutation occurs within an exon. Additionally, if the ribosome has to wait too long to receive the amino acid, the ribosome could terminate translation prematurely
Which of the following may render a silent mutation in an mRNA relevant? A) micro RNA...
D Question 4 A silent mutation has no change in RNA sequence O no change to DNA, RNA, or protein O no change in protein sequence O no change in DNA sequence Question 5 Which mutation changes one amino acid for another? nonsense all of these are correct missense silent
Which of the following does not come in contact with the ribosome? mRNA, RNA , tRNA, DNA
1. Which of the following statements about the flow of genetic information is true? a. Proteins encode information that is used to produce other proteins of the same amino acid sequence. b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins. c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA. d. DNA encodes information that is translated into RNA, and RNA...
53. RNA polymerases differ from DNA polymerases in that A. RNA polymerases are less effective at proofreading than DNA polymerases. B. only DNA polymerases are processive. C. RNA polymerases do not require a template. B. DNA polymerases use ribonucleoside triphospates as substrates. E. RNA polymerases use deoxyribonucleoside triphosphates as substrates. 54. Which of the following might be a tRNA anticodon for leucine? A. 5-AAC-3' B. 3'-AAC-5'. C. 5'-TTC-3'. D. 3'-UUG-5'. E. 5-UUG-3'. 55. During protein synthesis, ribosomes A. translate mRNA...
Multiple RNA molecules are important in translation: mRNA, tRNA, and rRNA. Which of the following is most likely to slow the production of a single protein in the cytoplasm? Downregulation of genes encoding tRNA components. An increase in the synthesis of the 80S ribosomal proteins important in ribosomal translational initiation. Recruitment of RBPs that promote RNAse degradation to the 3’UTR of the mRNA transcript. Mutations in mitochondrial tRNAs important in the synthesis of mitochondrial proteins.
Which of the following RNA types primarily localize to and function in the nucleus? 1. mRNA 2. miRNA 3. snoRNA 4. hnRNA 5. tRNA 2 and 4 1 and 3 2, 3, and 4 3 and 4
Amongst RNAs, which of the following RNA types found in cells are relatively unstable? Amongst RNAs, which of the following RNA types found in cells are relatively unstable? Please explain. A. mRNA B. rRNA C. tRNA D. snRNA E. All are equally unstable F. Answers (2) and 3) G. Answers (2), (3), and (4)
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up...
answer all the questions
18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...