Question

1. Which of the following statements about the flow of genetic information is true? a. Proteins...

1. Which of the following statements about the flow of genetic information is true?

a. Proteins encode information that is used to produce other proteins of the same amino acid sequence.

b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins.

c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA.

d. DNA encodes information that is translated into RNA, and RNA encodes information that is translated into proteins.

e. None of the above

2. RNA polymerase uses the _______ DNA template to synthesize a _______ mRNA.

a. 5′ to 3′; 5′ to 3′

b. 3′ to 5′; 3′ to 5′

c. 5′ to 3′; 3′ to 5′

d. 3′ to 5′; 5′ to 3′

e. Examples of all of the above have been found.

3. Which of the following molecules transfers information from mRNA to protein?

a. DNA

b. mRNA

c. tRNA

d. Proteins

e. Lipids

4. The genetic code is best described as

a. redundant but not ambiguous.

b. ambiguous but not redundant.

c. both ambiguous and redundant.

d. neither ambiguous nor redundant.

e. nonsense.

5. The three codons in the genetic code that do not specify amino acids are called

a. missense codons.

b. start codons.

c. stop codons.

d. promoters.

e. initiator codons.

6. DNA is composed of two strands, only one of which typically is used as a template for RNA synthesis. By what mechanism is the correct strand chosen?

a. Both strands are tried and the one that works is remembered.

b. Only one strand has the start codon.

c. The promoter acts to aim the RNA polymerase.

d. A start factor informs the system.

e. It is chosen randomly.

7. The major phenotypic expression of genotype is in

a. proteins.

b. tRNA.

c. mRNA.

d. nucleic acids.

e. a mutation.

8. Which of the following mutations would probably be the most deleterious?

a. A missense mutation in the second codon

b. A frameshift mutation in the second codon

c. A nonsense mutation in the last codon

d. A silent mutation in the second codon

e. All of the above would be equally deleterious.

9. Which of the following molecules transfers information from the nucleus to the cytoplasm?

a. DNA

b. mRNA

c. tRNA

d. Proteins

e. Lipids

10. Transcription is the process of

a. synthesizing a DNA molecule from an RNA template.

b. assembling ribonucleoside triphosphates into an RNA molecule without a template.

c. synthesizing an RNA molecule using a DNA template.

d. synthesizing a protein using information from a messenger RNA.

e. replicating a single-stranded DNA molecule.

11. If the codon is 5¢-GAA-3¢, then the corresponding anticodon is

a. 5¢-GAA-3¢.

b. 3¢-GAA-5¢.

c. 5¢-CUU-3¢.

d. 3¢-CUU-5¢.

e. 3¢-CTT-5¢.

12. Which of the following statements about pre-mRNA splicing is false?

a. It removes introns in eukaryotic genes.

b. It is performed by small nuclear ribonucleoprotein particles (snRNPs).

c. It is common in prokaryotes.

d. It is directed by consensus sequences.

e. It shortens the RNA molecule.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. Which of the following statements about the flow of genetic information is true?

answer- d. DNA encodes information that is translated into RNA, and RNA encodes information that is translated into proteins.

information flows from DNA --- RNA --- Protein

please give a thumbs up!!!!!thank you!!!!

Add a comment
Know the answer?
Add Answer to:
1. Which of the following statements about the flow of genetic information is true? a. Proteins...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1) The universal genetic code is used to translate aminoacids from a. codons in the DNA...

    1) The universal genetic code is used to translate aminoacids from a. codons in the DNA b. codons in the mRNA c. codons in tRNA d. codons in rRNA 2) In RNA, introns are: a. nucleotide sections that do not code for proteins and are not removed before translation b. nucleotide sections that code for proteins and must be removed before transcription c. nucleotide sections that do not code for proteins and must be removed before translation d. nucleotide sections...

  • Question 2 Imagine you are a scientist who intends to cure sickle cell disease. Which approach...

    Question 2 Imagine you are a scientist who intends to cure sickle cell disease. Which approach would be best suited to this goal? a. Dietary supplements to make up for an enzyme deficiency b. Modification of ribosomes to enhance translation c. Exposure to X-rays to induce a new mutation d. Dietary supplements to make up for an amino acid deficiency e. Editing the gene for a polypeptide component of hemoglobin Question 7 Stop codons terminate translation by a. increasing peptidyl...

  • 1. A codon is present in ____. An anticodon is found in ___. The 5'- AUC-3'...

    1. A codon is present in ____. An anticodon is found in ___. The 5'- AUC-3' codon, will base pair with the 5'- _____3' anticodon a)mRNA,tRNA,UAG b)mRNA,tRNA,GAT c)DNA,mRNA,GAU d) mRNA, tRNA, GAU e) DNA,mRNA,CUA 31. The existence of Okazaki fragments supports the ___ model of DNA replication a) semi-conservative b)bidirectional c) conservative d) continious e)semi-discontiniouus 32. The human immunodeficiency virus (HIV) a retrovirus injects its genomic material composed of ___ into the host t cell; this must be ___ into___...

  • What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...

    What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • 7-41 Which of the following pairs of codons might you expect to be read by the...

    7-41 Which of the following pairs of codons might you expect to be read by the same tRNA as a result of wobble? (a) (b) CUU and UUU GAU and GAA CAC and CAU (d) AAU and AGU Below is a segment of RNA from the middle of an mRNA 7-42 5'-UAGUCUAGGCACUGA-3 ' If you were told that this segment of RNA was part of the coding region of an mRNA for large protein, give the amino acid sequence for...

  • Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA...

    Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n) intron. mutation. gene. codon. Flag this Question Question 3 1 pts A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence? CGT...

  • 1, If alternative splicing was not available, what impact would this have? Individuals would need more...

    1, If alternative splicing was not available, what impact would this have? Individuals would need more DNA to code for proteins Individuals would need less DNA to code for proteins Individuals would not be able to make different proteins from the same sequence of DNA Both A and C None of the above 2, An individual has a mutation that adds one base to the sequence of DNA. What type of mutation is this most likely to cause? Silent Mis-Sense...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • 1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or...

    1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or B) serves as the TEMPLATE strand for the transcription of a mRNA that contains both a start and a stop codon?    3.) Which number (1, 2, 3, 4, or 5) best approximates the location of the -10 consensus sequence?    4.) How many amino acids long is the protein encoded by the mRNA from this DNA sequence?    5.) What is the second...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT