HomeworkLib
Question

Which of the following RNA sequences will form a stem loop (hairpin) structure? None of these...

Which of the following RNA sequences will form a stem loop (hairpin) structure?

None of these sequences are likely to form a stem loop.

5' AACCUGCGACUAUUGGACGC 3'

5' AACCUGCGACUAUUGGAGCG 3'

5' AACCUGCGACUAAACCUGCG 3'

5' AACCUGCGACUACGCAGGUU 3'
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

The answer is:

5' AACCUGCGACUACGCAGGUU 3'

0 0
Add a comment
Know the answer?
Add Answer to:
Which of the following RNA sequences will form a stem loop (hairpin) structure? None of these...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Q3 If the formation of a hairpin loop requires a minimum stem length of 6 contiguous...

    Q3 If the formation of a hairpin loop requires a minimum stem length of 6 contiguous base pairs and at least 3 nucleotides in the loop, which of the two single-stranded DNA molecules shown below may form a hairpin loop? Draw the hairpin loop(s) 5’-ACGGGCTTTTGGAAAGGGCCCT 5’-ATTGGTGTGGAAAACCACACCCC

  • Transcription is terminated, when a characteristic RNA structure _____ is formed by local RNA palindromic sequences...

    Transcription is terminated, when a characteristic RNA structure _____ is formed by local RNA palindromic sequences at the 3’- end. The structure interacts with RNAP-bound NusA, causing dissociation of RNAP from template DNA. The RNAP dissociation is stimulated by sequence-specific binding of _____ proteins to the transcribed RNA, enhancing termination of transcription. Select one: a. hairpin ;;;; rho b. hairpin ;;;; sigma c. beta-turn ;;;; rho d. beta-turn ;;;; sigma e. None of these

  • 34. Transcription is terminated, when a characteristic RNA structure is formed by local RNA palindromic sequences...

    34. Transcription is terminated, when a characteristic RNA structure is formed by local RNA palindromic sequences at the 3-end. The structure interacts with RNAP-bound NusA, causing dissociation of RNAP from template DNA. The RNAP dissociation is stimulated by sequence specific binding of proteins to the transcribed RNA, enhancing termination of transcription Select one a. hairpin - rho b. hairpin sigma c. beta-turn rho d. beta-turn sigma e. None of these

  • 5. Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure? a. GACCGTATGC...

    5. Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure? a. GACCGTATGCACGGTC b. TCATAGGCGCCGTTCA c. GGATCACGTTACCGCC d. ATAAGATGGGAGCATG The structures below represent the 8 D stereoisomeric aldohexoses. Answer the following (6-7) based on this figure Si carbons ---OH H= =QH --OH H--OH CH,OH HO--- H=CHCH -- - OH CH,OH ---CH HỌC 6 -- - OH Chon D-Glucose HO-- H H -- - OH CH,OH -Marnese -- Hà QH HO--- - OH CHOH Giese HO--...

  • Transfer RNA molecules are short RNA sequences (on average around 78 nucleotides long) that form a...

    Transfer RNA molecules are short RNA sequences (on average around 78 nucleotides long) that form a stem-and-loop structure, where one of the loops carries the anticodon that binds with the appropriate codon in the messenger RNA. At least 30 different tRNA genes are required by each cell to specify translation, but each of these tRNA genes can occur in multiple copies in a single genome, often co-located in clusters. How might these features of tRNA structure and function influence the...

  • Which type of transcriptional termination requires formation of a stem loop secondary structure in the RNA?...

    Which type of transcriptional termination requires formation of a stem loop secondary structure in the RNA? What is the primary factor involved in the termination of RNA synthesis? Is a new nucleotide added to a growing strand of RNA at the 3′ end? DNA and associated histones compose what molecule? Be able to use a codon table to give the sequence of amino acids from an mRNA sequence. I will give you an mRNA sequence; you will indicate how many...

  • Which of the following is a chemical or structural characteristic of RNA? The RNA sugar is...

    Which of the following is a chemical or structural characteristic of RNA? The RNA sugar is ribose, which has an OH group on the 2' carbon. O RNA is usually a single-stranded molecule. The bases in RNA include uracil instead of thymine. RNA molecules are generally shorter in length compared DNA macromolecules. All of the above are either a chemical or structural characteristic of RNA. Which of these sequences could form a hairpin? 5' GGGGTTTTCCCC 3' 5' AAAAAAAAAAAA 3' 5'...

  • Which of the following is (are) characteristic of rho-independent termination of RNA transcription in E. coli?...

    Which of the following is (are) characteristic of rho-independent termination of RNA transcription in E. coli? A) The 3' end of the RNA transcript contains self-complementary inverted sequences that form a hairpin. B) The DNA sequence that encodes the 3”end of the RNA transcript contains a polyA repeat sequence in the coding strand. C) The DNA sequence that encodes the 3”end of the RNA transcript contains a polyT repeat sequence in the coding strand. D) Both A and C.

  • TVI HOUSE (v) contains U rather than T bases. (vi) may contain stem-loop structure. 6. If...

    TVI HOUSE (v) contains U rather than T bases. (vi) may contain stem-loop structure. 6. If you have samples of pure RNA and duplex DNA, how can you tell whether they have any complementary nucleotide sequences?

  • Hgs is a major target of the Ire1-dependent RNA decay pathway. Mutation of a particular stem-loop...

    Hgs is a major target of the Ire1-dependent RNA decay pathway. Mutation of a particular stem-loop sequence in the Hgs mRNA abolishes its degradation during ER stress. What would you conclude from this result? the stem-loop is necessary and sufficient for degradation the stem-loop is sufficient for degradation the stem-loop is necessary but not sufficient for degradation the stem-loop is necessary for degradation Which of the following processes is most likely to be affected by lysosome localization/positioning in the cell?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT