Question

1a. Which of the following DNA strands, the top or bottom, would serve as a template...

1a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction?
5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′
3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′
⎯⎯⎯⎯→
Direction of DNA unwinding
b. What would be the resulting RNA sequence (written 5′→3′ )?

2. You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in
the following scenarios.
a. Helicases unwind the DNA, but stabilizing proteins are mutated and cannot bind to the DNA.
b. The mRNA molecule forms a hairpin loop on itself via complementary base pairing in an area spanning the
AUG start site.
c. The cell is unable to produce functional tRNAi Met

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1a. The 3'-5' strand will act as a template strand for transcription. As we know synthesis of a nucleotide chain requires a free 3'OH group. Therefore the 3'-5' strand will act as a template strand for transcription.

1.b. The nucleotide sequence would be

5'-ACGGACUGUACCGCUGAAGUCAUGGUCGCUCGU-3'

2.A. If the DNA strand stabilising proteins also known as single strand binding proteins are mutated and they don't function then the parts melted by helicase will rejoin and the DNA strand won't open and the DNA polymerase won't start the replication process.

2.B. If the m-RNA forms a hairpin loop via complementary base pairing in the region were the translation start codon 5'-AUG-3' is situated then the peptide synthesis via translation from the m-RNA won't happen. As the ribosomal subunits scans for the AUG start codon to initiate translation.

2.C tRNAi(met) is the initiator t-RNA in the eukaryotic system and it helps the ribosome sub units in the scanning and identification of the start codon 5'-AUG-3'. If the cells are not able to produce functional t-RNAi then the translation process will be hampered.

Add a comment
Know the answer?
Add Answer to:
1a. Which of the following DNA strands, the top or bottom, would serve as a template...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

  • Match the following (Total 24 pts) Enzyme responsible for joining DNA strands together The nascent DNA...

    Match the following (Total 24 pts) Enzyme responsible for joining DNA strands together The nascent DNA strand that is being synthesized in the same direction as the replication fork. Enz 39 DNA polymerase 40 DNA helicase responsible for transcribing RNA 41DNA sliding clamp 42 Single Stranded Binding Proteins DShort, newly synthesized DNA fragments 43 RNA primer 44 DNA ligase formed on the lagging template strand E Abundle or proteins that assist in the rate of transcription of DNA to mRNA....

  • “Unlike what happens in DNA replication, where both strands are copied, only one of the two...

    “Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...

  • Which of the following is NOT a function of transcription that requires the activity from subunits...

    Which of the following is NOT a function of transcription that requires the activity from subunits of the Core RNA Palymerase? a. RNA polymerase activity that base-pairs and polymerizes nucleotides to make mRNA. b. Helicase activity that unwinds the double-stranded DNA molecule for transcription c. Specific recognition of -35 box and -10 box sites in the promoter region. d. General binding that helps RNA polymerase loosely adhere to DNA, before Transcription begins. Oe. Trick Question. The Core RNA polymerase can...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • Develop 3 individual DNA strands that includes all 4 bases and are each 40 bases long....

    Develop 3 individual DNA strands that includes all 4 bases and are each 40 bases long. (include directionality for each strand) TT I Arial 3(1201·T·EE: 5.00 From the 3 strands that you just developed, determine the consensus sequence. (include directionality) TT T Arial 3(12pt) T. - E . ES Determine the complementary strand to your consensus sequence with correct base pairing and include directionality for each strand Highlight the strand that would be your template for transcription TTT Arial 3(12pt)...

  • 1a. What is the basis for the difference in how the leading and lagging strands of...

    1a. What is the basis for the difference in how the leading and lagging strands of DNA molecules are synthesized? a. the orgins of replication occur only at the 5' end b. DNA ligase works only in the 3'->5' direction c. helicases are single stranded binding proteins work at the 5' end d. DNA polymerase can join new nucleotides only to the 3' end and of a preexisted strand, and the strand are antiparallel. ------------------------------------------------------------------------------------------------------------------------------------------- 1b. DNA polymerase; a. do...

  • BIU A A E 8. A DNA molecule has two strands (double helix) – how many...

    BIU A A E 8. A DNA molecule has two strands (double helix) – how many of its strands are/is used during replication and transcription? 9. What is the difference between transcription and translation occurring in Prokaryotes and eukaryotes? 10. What is the relation between mRNA and genetic code? 11. Using genetic code table-list the corresponding aminoacids for triplet code: CAG, GAG, CAC, AUA, GUA, GCA and UGA, UAA and UAG 12. How many start and stop codons are there?...

  • 10. Select all TRUE answers for the following terms. (7 points) DNA Replication (2 points) a....

    10. Select all TRUE answers for the following terms. (7 points) DNA Replication (2 points) a. Copies both strands of DNA at the same time. b. Occurs only during S phase of cell cycle. C. Generates RNA from DNA template. d. Necessary for mitosis, but not meiosis. DNA Transcription (2 points) a. Substitutes Guanine (DNA) for Uracil (RNA). b. Produces RNA with complementary sequence to DNA template. C. Generates RNA from both strands of DNA at the same time. d....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT