Question

1 of Constants i Periodk Table order of DNA nucieotides What is the anino acid order produced from this mRNA? Express your answer as a sequence of three-Jetter amino acid 5 UCU AAG GCA UUC 3 Part B What is the amino acid order if a point mutation changes UCU to CCU? Express your answer as a sequence of three-letter amino acid abbreviations s respectively (e.g., Tyr-Val... .le STOP). eparated by dashes and type START and STOP for start and stop codons, Request O Type here to search

media%2Fd4f%2Fd4ff27fe-8e3f-4af2-a01f-3d

media%2Fd2a%2Fd2a2ed8a-8a0a-4916-99d0-1d

0 0
Add a comment Improve this question Transcribed image text
Answer #1

I have solved and written the amino acid sequence of each of the question in the picture provided by you only, so please take a look-

The answers are written with brown ink.

1)

1 of Constants i Periodic Table PartA Consider the following segment of mRNA produced by the normal order of DNA nucleotides What is the amino acid order produced from this mRNA? 5 UCU AAG GCA UUC 3 Express your answer as a sequence of three-Jetter amino acid abbreviations separated by dashes and type START and STOP tor start and stop codons, respectively (e-g. Tyr-Val..-le STOP) You may want to reference (Pages 600-604) Section 17.6 whie completing this problem 5-Ser-Lys-Ala-Phe-3 Submit Previous Answers Request Answe X Incorrect: Try Again; 3 attempts remaining Part B What is the amino acid order if a point mutation changes UCU to CCU? codons, ess your answer as a sequence of three-letter amino acid abbreviations separated by dashes and type START and STOP for start and stop respectively (e.q. Tyr-Val- lle STOP). 5-Pro-Lys-Ala-Phe-3 Submit Request Answer O Type here to search

2)

3)

Hope it helps, Good luck !!!!
Please do press like !!!! :)

Add a comment
Know the answer?
Add Answer to:
1 of Constants i Periodk Table order of DNA nucieotides What is the anino acid order...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • D) Consider that during replication of the cell. the following mutations were generated within the gene...

    D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...

  • Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids....

    Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids. The words Introduction: The instructions coded in DNA must be read and turned into pro molecules for the cell to carry out the instructions. In this activity you will model this process using sentences for DNA and RNA and words for amino acids. The words must line up in the correct order for the protein to form properly, just like words in a sentence...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...

  • mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha...

    mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT