Question

Genetic engineers are trying to construct a new type of bacterial cell in which one of...

Genetic engineers are trying to construct a new type of bacterial cell in which one of the 20 amino acids, alanine, is replaced by a synthetic amino acid,

0 0
Add a comment Improve this question Transcribed image text
Answer #2

amino acyl tRNA synthetase

Add a comment
Answer #3

amino acyl tRNA synthetase

Add a comment
Answer #4

b. amino acyl tRNA synthetase.

An aminoacyl tRNA synthetase is an enzyme, which catalyzes the esterification of a specific cognate aminino acid to its compatible cognate tRNAs thus, forming an aminoacyl-tRNA. If this enzyme is not modified, the new amino acid may ot be recognised by the enzyme.

Add a comment
Know the answer?
Add Answer to:
Genetic engineers are trying to construct a new type of bacterial cell in which one of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and Lys, respectively. E...

    The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and Lys, respectively. Explain the reason why polyG was not used as a translation template in these experiments. Match the words in the left column to the appropriate blanks in the sentences on the right. RNA polymerase To establish codons for different amino acids Nirenberg and Matthaei polymerized is physically unstable molecules with the to synthesize polyN, a polyribonucleotide containing only one...

  • A substitution mutation is one in which one nucleotide base is changed to another

    2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...

  • DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...

    DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...

  • 1. The type of genetic exchange between bacterial cells that can happen between isolated DNA and...

    1. The type of genetic exchange between bacterial cells that can happen between isolated DNA and a live bacterial cell is: a. conjugation b. transduction c. transversion d. transformation 2. An Hfr strain of E. coli with genotype a+b+c+d+e+f+ is mated with an F¯ auxotrophic strain with the genotype a¯b¯c¯d¯e¯f¯. Conjugation is stopped at 10 minute intervals and the genotypes of the resulting conjugants are determined. The following results are obtained: after 10 minutes e+ after 20 minutes a+ e+...

  • Acids are, by nature, generally polar compounds. Which bacterial type is likely to be more affected...

    Acids are, by nature, generally polar compounds. Which bacterial type is likely to be more affected by acid-based disinfectants? Gram-positive bacteria Gram-negative bacteria

  • Mitosis results in two daughter cells. When comparing the genetic information of the parent cell with...

    Mitosis results in two daughter cells. When comparing the genetic information of the parent cell with that of the two daughter cells, all three are identical. the two daughter cells are identical but slightly different from the parent cell. all three are slightly different. the parent cell and one daughter cell are identical, while the second daughter cell is slightly different. outcome patterns vary. What purpose do restriction enzymes play in bacterial cells? They prevent the overproduction of mRNA in...

  • Which of the following statements is NOT consistent with the four principles of evolution? a. Genetic...

    Which of the following statements is NOT consistent with the four principles of evolution? a. Genetic mutations are random and are not "designed" to guide evolution in a given direction. b. The development of new structures or features of an organism can occur spontaneously and do not have to arise from existing features - this helps account for the diversity among all organisms on earth. c. Evolution occurs continuously and is still happening. d. A genetic variation that allows an...

  • 1. Amino acids have both a three letter, and a one letter code, for example the...

    1. Amino acids have both a three letter, and a one letter code, for example the amino acid Glycine is “Gly” or “G.” There are 20 single letter codes for amino acids, which is almost an entire alphabet. (skip any letters without a corresponding amino acid) it would make. A. For example:  “Ryan Smith”, would be: “Arginine, Tyrosine, Alanine, Asparagine, Serine, Methionine, Isoleucine, Threonine, Histidine” B. Take this sequence of amino acids, and write out a sequence of RNA that could...

  • THIS IS BIOCHEMISTRY A peptide has a low pI value. Which of the following amino acids...

    THIS IS BIOCHEMISTRY A peptide has a low pI value. Which of the following amino acids are likely to be present? Glycine Serine Valine Aspartic aci Arginine    The R-groups of which of the following pairs of amino acids could participate in the formation of salt bridge electrostatic interaction? Alanine and valine Valine and lysine Lysine and glutamate Serine and isoleucine Asparagine and glutamine Which of the following interactions does NOT contribute to stabilizing tertiary structure? Hydrophobic interactions Electrostatic interations...

  • QUESTION 45 Conjugation between bacterial cells involves the equal contribution of genetic material from one bacterial...

    QUESTION 45 Conjugation between bacterial cells involves the equal contribution of genetic material from one bacterial cell to the other. True False 2 points QUESTION 46 Is made up of only a single-stranded RNA molecule that does not code for any proteins. Virus Prion Viroid 2 points QUESTION 47 Mutagens can cause mutations by _______. Covalently altering the structure of the nucleotides. Causing errors in DNA replication by disrupting the appropriate pairing between nucleotides. Distorting the helical structure of the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT