Question

Three short sequence reads from a genomic library made by partial digestion with Sau 3Al and ligation into the Bam Hl site of plasmid vectors are shown below. Do all three of the following 20 nt sequence reads generate a single contig? If so, how long is that contig? (For the purpose of this question, 8 nt of sequence overlap is sufficient for any two reads to form a contig.) read 1: 5' AAAGTCAACCTGTATTGGCC 3 read 2: 5' GCGCGCTATAGGCCAATACA 3' read 3: 5' TATAGCGCGCAATTTTTGGG 3

Answer 1

3. No.

It is not possible to make a single contig from these 3 sequence reads as there are not any atleast 8 nt sequence similarity between two reads.