where you cut GFP out of the pGLO vector without cutting into the coding portion of...
Homework Answers
Green fluorescent protein (GFP) is a protein that glows with a bright green fluorescence when exposed to ultraviolet light. The gene sequence coding for GFP was first isolated from the marine jellyfish Aequorea victoria and has since been widely used in cellular and molecular biology as a reporter to detect gene expression in transgenic organisms. The pGLO plasmid contains the GFP gene and other functional DNA sequences that enable its use for bacterial transformation and expression
pGLO plasmid replacing it's GFP gene which is around 700bp long.The pGLO plasmid is 5371 bp. The GFP coding region is about 714 bp, and the GFP protein is about 26 kD, with 238 amino acids.
- calculating the average molecular weight of DNA according to the charge ratio, should we multiply the average number of base pairs in the single strand or double strand with the average molecular weight per base pair, which equals to 660 g/mol.
- The number of base pairs should be multiplied by the average molecular mass of one base pair (660 g/mol) to get the approximate mass of the whole double-stranded DNA molecule, such as a plasmid. If the DNA is single-stranded, then multiply the number of bases by the average mass of a single base (330 g/mol) to get the approximate mass of the whole molecule
Add Answer to:
where you cut GFP out of the pGLO vector without cutting into the
coding portion of...
D 4. You want to use PGLO to produce red fluorescent protein (RFP) instead of green...
D 4. You want to use PGLO to produce red fluorescent protein (RFP) instead of green fluorescent protein (GFP). To do so, you cut out the GFP gene from PGLO with two restriction enzymes, and replace it with the coding sequence for RFP. Which two restriction enzymes will you choose to cut the RFP gene (out of a different plasmid) prior to ligating it into the PGLO plasmid? Select all that apply EcoRI EcoRV Ndel Psti Nhel D 3. You...
You want to use PGLO to produce red fluorescent protein (RFP) instead of green fluorescent protein...
You want to use PGLO to produce red fluorescent protein (RFP) instead of green fluorescent protein (GFP). To do so you cut out the GFP gene from PGLO with two restriction enzymes, and replace it with the coding sequence for REP After you successfully created a modified version of the PGLO plasmid with the RFP in place of the GFP you transform this plasmid into E. coli and plate it onto LB plates containing both ampicillin and arabinose. After an...
Based on the following picture: 1- Write the DNA sequence of the recombinant pET/GFP plasmid beginning...
Based on the following picture:
1- Write the DNA sequence of the recombinant pET/GFP plasmid
beginning at the ATG translational start codon and continuing
through the first 4 codons (triplets) of the GFP coding region. Put
a box around the NheI site.1-
2- Also, based on the DNA sequence you have written out above,
write the amino acid sequence of the protein that is encoded by
this DNA. Box the His-tag. Underline the region that corresponds to
the GFP protein...
D7. Looking at your staging results, which phase of the cell cycle does the cell spend...
D7. Looking at your staging results, which phase of the cell cycle does the cell spend the most time in? interphase prophase metaphase anaphase telaphase cytokinesis 8. if we were using slides from a frog instead of an onion to do this lab, which cell type do you think would be best for us to view mitosis? frog skin frog embryo frog brain frog muscle D5. You want to use PGLO to produce red fluorescent protein (RFP) instead of green...
Answer the following questions that do not have an answer. Creating a graph is not necessary....
Answer the following questions that do not have an answer.
Creating a graph is not necessary. Thanks!!!
You introduced the pGlo vector into E. coli which carried the
GFP gene under the control of the arabinose
promoter. Based on what you know about the arabinose
promoter, when did you expect GFP to be expressed?
I expected the green fluorescence
protein to be expressed when arabinose was present.
What hypothesis was tested by the experiments you performed
after the pGlo vector was...
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple...
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
a) You cut a gene out of the DNA of a eukaryotic cell and insert it into...
a) You cut a gene out of the DNA of a eukaryotic cell and insert it into the DNA of a bacterial cell. You find that the bacteria do not produce the protein you wanted but instead, a much larger disorganized protein is produced. Explain what happened. b) Your teammate claims to have found a mutation in the serine tRNA synthetase that causes serine amino acids to be linked to a tRNA with a UAA anti-codon. Is this possible? If so,...
a. You cut a gene out of the DNA of a eukaryotic cell and insert it...
a. You cut a gene out of the DNA of a eukaryotic cell and insert it into the DNA of a bacterial cell. Much to your dismay you find that the protein product you want is not produced by the bacteria but instead a much larger disorganized protein is produced. Explain what is going on. b. Your lab mate claims to have found a mutation in the serine tRNA synthetase that causes serine amino acids to be linked to a...
e) (2 points) Your supervisor suggests you produce a cDNA library for the yeast in order...
e) (2 points) Your supervisor suggests you produce a cDNA library for the yeast in order to produce the genes in bacteria and perform enzymatic analysis. You do so and are able to isolate a vector for your gene (you call this gene Yuml). You send your vector in for sequencing and are given the sequence of your gene and surrounding regions (shown below). 5' TCCGGCGGAATTCCAAGGCCT 3' AGGCCGCCTTAAGGTTCCGGA Yum1 CGTCGACTCCGGC GCAGCTGAGGCCG 3' 5' You want to PRC amplify your specific...
Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from...
Your friend decides to place Green Fluorescent Protein (GFP)
under the control of the promoter from the lacZ gene we discussed
in class. She put this expression plasmid into a bacterium. The
promoter from the lacZ gene is diagrammed to the right.?
2) Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from the lacZ gene we discussed in class. She put this expression plasmid into a bacterium. The promoter from the lacZ gene...
D 4. You want to use PGLO to produce red fluorescent protein (RFP) instead of green fluorescent protein (GFP). To do so, you cut out the GFP gene from PGLO with two restriction enzymes, and replace it with the coding sequence for RFP. Which two restriction enzymes will you choose to cut the RFP gene (out of a different plasmid) prior to ligating it into the PGLO plasmid? Select all that apply EcoRI EcoRV Ndel Psti Nhel D 3. You...
You want to use PGLO to produce red fluorescent protein (RFP) instead of green fluorescent protein (GFP). To do so you cut out the GFP gene from PGLO with two restriction enzymes, and replace it with the coding sequence for REP After you successfully created a modified version of the PGLO plasmid with the RFP in place of the GFP you transform this plasmid into E. coli and plate it onto LB plates containing both ampicillin and arabinose. After an...
Based on the following picture:
1- Write the DNA sequence of the recombinant pET/GFP plasmid
beginning at the ATG translational start codon and continuing
through the first 4 codons (triplets) of the GFP coding region. Put
a box around the NheI site.1-
2- Also, based on the DNA sequence you have written out above,
write the amino acid sequence of the protein that is encoded by
this DNA. Box the His-tag. Underline the region that corresponds to
the GFP protein...
D7. Looking at your staging results, which phase of the cell cycle does the cell spend the most time in? interphase prophase metaphase anaphase telaphase cytokinesis 8. if we were using slides from a frog instead of an onion to do this lab, which cell type do you think would be best for us to view mitosis? frog skin frog embryo frog brain frog muscle D5. You want to use PGLO to produce red fluorescent protein (RFP) instead of green...
Answer the following questions that do not have an answer.
Creating a graph is not necessary. Thanks!!!
You introduced the pGlo vector into E. coli which carried the
GFP gene under the control of the arabinose
promoter. Based on what you know about the arabinose
promoter, when did you expect GFP to be expressed?
I expected the green fluorescence
protein to be expressed when arabinose was present.
What hypothesis was tested by the experiments you performed
after the pGlo vector was...
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
e) (2 points) Your supervisor suggests you produce a cDNA library for the yeast in order to produce the genes in bacteria and perform enzymatic analysis. You do so and are able to isolate a vector for your gene (you call this gene Yuml). You send your vector in for sequencing and are given the sequence of your gene and surrounding regions (shown below). 5' TCCGGCGGAATTCCAAGGCCT 3' AGGCCGCCTTAAGGTTCCGGA Yum1 CGTCGACTCCGGC GCAGCTGAGGCCG 3' 5' You want to PRC amplify your specific...
Your friend decides to place Green Fluorescent Protein (GFP)
under the control of the promoter from the lacZ gene we discussed
in class. She put this expression plasmid into a bacterium. The
promoter from the lacZ gene is diagrammed to the right.?
2) Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from the lacZ gene we discussed in class. She put this expression plasmid into a bacterium. The promoter from the lacZ gene...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago