the right option the given question is
Deletion of the start codon
because, Without a start codon, the process of translation would never begin. Without a stop codon, the translation of RNA to a protein would not end at a place in which a proper protein could be constructed. Neither codons would result in a failure to complete translation altogether
I will give thumbs up Which of the following mutations would lead to a change in...
help please
Which of the following mutations would lead to a change in the reading frame in translation? Deletion of the start codon Insertion of CTA Insertion of six Adenins Deletion of two Cytocins
1) Which of the following mutations could result in a frameshift? A) a base insertion B) a base deletion C) a base substitution D) either A or B E) A, B, and C 2) Which of the following point mutations would be most likely to result in a non-functioning protein? A) a single base substitution in an intron B) a single base deletion near the end of the coding sequence C) a single base deletion in the codon following the...
The discovery of amber mutations by Sydney Brenner and colleagues was a group of mutations that were eventually shown to be.. a unusual amino acid that generated an amber color in the affected bacteria. b. a deletion mutation that creates a translational frameshift. Insertion mutation that creates a translational frameshift. d. premature stop codon within the gene's open reading frame. e previously unknown signal for speeding the translation process (as in "an amber light means speed up before the light...
Use the Mutations interactive
to determine which statements describe silent mutations. The
adenine of the start codon is position +1.
a substitution from G to T in the arginine codon of the
antisense stand
a substitution of a G nucleotide at position +9 in the antisense
strand
a transition at position +6 in the sense strand
a transversion of A in the histidine codon of the antisense
strand
a single nucleotide deletion at position +12 in the antisense
strand
a...
Which of the following mutations could result in a truncated protein? Choose all that apply. A missense mutation that changes a phenylalanine to a leucine O A two base pair frameshift O An in-frame removal of three base pairs O A one base pair frameshift A chromosomal-level deletion O o A chromosomal-level insertion O A nonsense mutation that changes a cysteine to a stop codon
Can someone outline how I would go from my DNA sequence to my
final product of coding the amino acids. I am confused on the
complimenting strands and which ones I would need.
Below is the coding sequence of very small prokaryotic gene. The coding sequence is shown in red while the regulatory sequences are shown in black and the UTR in blue. The underlined sequences denote the -10 sequence. The arrow marks the point of a 5 base insertion...
Which of the following mutations would be most likely to have a harmful effect on an organism? (A) a deletion of three nucleotides near the middle of a gene (B) a single nucleotide deletion in the middle of an intron (C) a single nucleotide deletion near the end of the coding sequence (D) a single nucleotide insertion downstream of, and close to, the start of the coding sequence In this problem, why (c) cannot be the answer?? Single nucleotide deletion...
Question 10 0.25 pts Which of the following is true of snRNPs? They bind to the TATA box of the promoter region of a gene. They bind to splice sites at each end of the exon. They join together to form a large structure called the spliceosome. They act only in the cytosol. They attach introns to exons in the correct order. Question 11 0.25 pts Which of the following types of mutation, resulting in an error in the mRNA...
Which of the following mutations would cause the most harmful effect: 1) a single base insertion near the beginning of the coding sequence or 2) a three base deletion towards the end of the coding sequence.
Please provide justifications for all answers so I
understand. Extra detail is very helpful. Thank you so
much.
Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...