
Variations in the temperature of growth and in the composition of the medium alter the proportions of individual fatty acids in the lipids of Escherichia coli. As the temperature of growth is 20 degree celsius, the proportion of unsaturated fatty acids (hexadecenoic and octadecenoic acids) increases. The increase in content of unsaturated acids with a decrease in temperature of growth occurs in both minimal and complex media. Cells harvested in the stationary phase contained large amounts of cyclopropane fatty acids (methylenehexadecanoic and methylene octadecanoic acids) in comparison with cells harvested during exponential growth. Cells grown in a chemostat, limited by the concentration of ammonium salts, show a much higher content of saturated fatty acids (principally palmitic acid) than do cells harvested from an exponentially-growing batch culture in the same medium. Cells grown in a chemostat, limited by the concentration of glucose, show a slightly higher content of unsaturated fatty acids than cells from the corresponding batch culture. The results do not indicate a direct relation between fatty acid composition and minimal growth temperature. As growth temperature is twenty degree celsius, the proportion of unsaturated acid increases. The percentage of the most abundant unsaturated fatty acid, octadecenoic acid, decreases continuously with growth temperature at 37 degree Celsius over the entire growth range. The most abundant saturated fatty acid, palmitic acid, increases continuously with i growth temperature at 37 degee celsius. The highest rate of change of these fatty acids occurs at high temperature. The percentage of the cyclopropane fatty acid, methylene hexadecanoic acid, also decreases with decreasing growth temperature, and ,3-hydroxymyristic acid is almost constant. The percentage of hexadecenoic acid increases only slightly at low temperature, but decreases dramatically above 40 C. Ratios of unsaturated to saturated fatty acids (Table 1) serve as useful indices of the degree of shift in fatty acid composition of the cells; e.g., the hexadecenoicpalmitic and octadecenoic-palmitic acid ratios both decrease approximately eightfold over the temperature range of 10 to 43 C.
Biochemistry: Membranes/metabolism 4. (6 pts) Membrane composition E. coli bacteria can be cultured at different temperatures....
Membrane's regulation Problem 4 (20 pts) - A culture of bacteria growing at 37°C was shifted to 25°C. How would you expect this shift to alter the fatty acid composition of the membrane phospholipids? Explain. If bacteria were able to synthesize cholesterol, how would you expect this shift to alter their membrane's cholesterol concentration?
(Bacteria cultured in saturated fatty acids at low temperature
vs high temperature)
(2) Saturated fatty acid (6) Cusaturated fatty acid l'almitic acid Linoleic acid 200: Sins Assxiatec Figure 1: Structure of saturated (a) and unsaturated (b) fatty acids (http://www.columbia.edu.cu biology courses/c2005/purves6/figure03-20.jpg) 1. Acholeplasma laidlawii is a bacterium that is unable to synthesize its own fatty acids and must therefore construct its plasma membrane from whatever fatty acids are available in the environment. Thus the A. laidlawii takes on the physical...
Which of these statements about the composition of membranes is true?A) All biological membranes contain cholesterol.B) Free fatty acids are major components of all membranes. C) The inner and outer membranes of mitochondria have different protein compositions.D) The lipid composition of all membranes of eukaryotic cells is essentially the same.E) The lipid: protein ratio varies from about 1: 4 to 4: 1Membrane proteins:A) ere sometimes covalently attached to lipid moieties:B) are sometimes covalently attached to carbohydrate moieties.C) are composed of...
(2 pts) You are studying lactose metabolism and have been culturing E. coliin different medias. One media has only glucose, one has only lactose, and a third has both glucose and lactose. (1 pt)You notice that some of the cultures grown in the presence of both glucose and lactose are metabolizing lactose. Which type(s) of mutation(s) could cause this to occur? (1 pt)You notice that some E. colicultures failed to grow in the presence of only lactose. You know that...
1. 2,4-Dinitrophenol (DNP) is a molecule that can shuttle protons across cellular membranes and was used in diet pills in the 1930s (but was quickly discontinued for its lethality). Explain how this molecule might induce weight loss, and why its consumption is often fatal. 2. Biosynthesis and breakdown of glucose share many common enzymes and reactions, but this is not the case in the metabolism of fatty acids. Compare and contrast fatty acid biosynthesis vs. beta-oxidation (location, acyl group carriers,...
sidering how cellular metabolism (catabolism and anabolism) works, explain why a bacteria. faster on this complex medium (glucose, beef extract, yeast extract, peptone, and water) vs. this fined/synthetic medium (sucrose, KzHPO., KH PO, (NH), HPO4, MgSO4, FeSO4, MnSO4, and water 6. Explain why Conside 4. Complement proteins, which are part of your immune system, can for large pores in the cytoplasmic 5. Escherichia coli is a facultative acrobe. Imagine a culture of E coli growing at 37°C in a complex...
6. Fatty acid synthase usually produces 16:0, but it sometimes can produce something longer or shorter. Let's assume it happens to produce 18:0. a) How many acetyl-CoA are required to make 18:07 (2 pts) b) How many NADPH are required to make 18:0? (2 pts) c) How many bicarbonate are required to make 18:07 (2 pts) d) In what cellular compartment does fatty acid biosynthesis take place? (2 pts) 7. A lipid bilayer consists solely of 1,2-distearoyl-sn-phosphatidylcholine. Assuming the bilayer...
1) Answer the following questions regarding Photosynthesis: A) In your own words, describe the steps of the linear electron flow pathway of photosynthesis (3 pts). Answer: B) Compare and contrast the cyclic electron flow pathway and the linear electron flow pathway (2 pts). Answer: 2) Describe the following regarding bacterial and archacal membranes and cell wall structures and indicate which groups of organisms (phyla of bacteria or genera of archaea) each type of cell wall is found: A) The membrane...
2. (6 pts) There are many different types of phages as they can RNA or DNA, and may be single stranded or double straned A) (3 pts) You isolate an unknown phage and fine it to have 20% A, 32% T, 25% G, and 33% C. What does this tell you regarding the classification of this phage? Why? B) (3 pts) This phage infects bacteria by integrating its DNA into the bacterial chromosome. The rate of success of this...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...