Ans 1: Phosphodiester bonds: In DNA, phosphodiester bond ate formed between the OH group of phosphoric acid and CH2 OH group of deoxyribose sugar by the removal of water. This is called as 3' -->5' phosphodiester bond as it denotes the phosphodiester bond between 3' - OH of 1st nucleotide and CH2OH of 5th carbon of deoxy ribose sugar.
Thus, phosphodiester bond connects two subsequent nucleotides.As can be seen from this picture

Here in this given question, 16 nucleotide are present in the single strand (upper), suggesting 15 phosphodiester bonds are present which are connecting these nucelotides.
Since, 2 strands are given in the question, 15 X 2 = 30.
Can be seen from this image,

Therefore, 30 phosphodiester bonds are present in the given question.
Ans 2. I have written all explanation in this image, with the answer.
Ans 3: As we know, in double
stranded DNA, Adenine in one strand forms 2 hydrogen bond with
Thymine in another strand whereas Guanine in one strand forms 3
hydrogen bond with cytosine in another strand. As can be seen in
this picture.

Marked in red are hydrogen bonds.
Total AT pairs in the given question are: 7
And one pair contains 2 hydrogen bonds, therefore, total hydrogen bonds in AT pair are : 7 X 2 = 14 hydrogen bonds.
Total GC pairs in this given in this given question are: 9
Therefore, as we know Number of hydrogen bonds in one GC pair are 3. Eventually Number of hydrogen bonds in total 9 GC pairs will be 9 X 3 = 27.
As we know now, total number of hydrogen bonds in this given question are are 14 + 27 is equal to 41 hydrogen bonds.
Ans 4. In DNA, two strands are there, the upper one which has polarity 3' to 5' and the lower strand which has complimentary polarity that is 5' to 3'. Generally the 3' group has free group hydroxyl group (3' - OH).
One strand has only one free 3' hydroxyl group.
will get more clear, one you will look this picture

Therefore, both the stand will have 2 free 3' - OH hydroxyl group.
Ans 5: GC ratio is the percentage of guanine and cytosine deciduous present in the overall DNA strand. In this given DNA strand total number of nucleotides are 32, out of which number of guanine and cytosine residues are 18.
GC ratio = G + C count/ A+ T + G + C count, multiplied by 100
G+ C count = 18
A + T + G + C count = 32
= 18/32
= 0.56 X 100
= 56%
I hope, you will not have any doubt further, and these answers will help you.
Question 16 How many of each of the following are in this double-standed piece of DNA?...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
DNA
Worksheet
DNA
by the numbers : Write the correct number in each blank ( when
necessary, assume we are talking about B DNA).
________ DNA strands in a double helix
________ hydrogen bonds in an A-T base pair
________ hydrogen bonds in a G-C base pair
_______nucleotides in one turn of a double helix
____nm between two bases on a strand of DNA
________ nm in one turn of a double helix
________ nm in diameter
________ the end...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
1. Which of the following is / are TRUE regarding a DNA molecule? a) A SINGLE DNA molecule consists of 2 nucleotide chains b) Covalent, phosphodiester bonds connect the nucleotides of a single nucleotide chain together c) Phosphodiester bonds join the separate nucleotide chains to one another forming a single molecule d) Hydrogen bonds join the separate nucleotide chains to one another forming a single molecule 2. During DNA replication, the enzyme helicase: a) Unwinds the double helix b) Functions...
Determine the number of hydrogen and phosphodiester bonds present in the following DNA fragment: 5-CAGCTG-3 3-GTCGAC-5 hydrogen bonds= 16; phosphodiester bonds= 10 hydrogen bonds=14; phosphodiester bonds=5 O hydrogen bonds= 10; phosphodiester bonds= 5 hydrogen bonds= 12; phosphodiester bonds-6
Question 3 (1 point) Match these terms relating to base pairing 1. hydrogen bonds link A-T and G-C. These make "rungs" of DNA ladder shape of RNA 2. number of bonds between Adenine & thymine, or between adenine and uracil complementary base pairing > phosphodiester linkage 3. weak, yet many hold DNA strands together, or RNA that folds back on itself < 2 4. shape of DNA Double helix 5. Single strand, but can fold back on itself to give...
QUESTION 2 Which of the following statement is true for both DNA replication and transcription? A. Both polymerases catalyze the formation of phosphodiester bonds between nucleotides. B. Primers are required to provide 3'-OH group for both polymerases to initiate the synthesis of DNA or RNA. C. DNA and RNA synthesis both proceed in a 5' to 3' direction or, in other words, nucleotides are added to the 3'- OH groups of the growing chains. D. Two of the above. O...
multiple answers are possible!
Which of the following statement about DNA is FALSE? When bacteriophage DNA was shown to be the agent necessary for production of new phages, this was the early experiment demonstrating that DNA is the hereditary material. During DNA replication, two replication forks are formed to complete the synthesis of the entire chromosome in eukaryotes. During bacterial DNA replication process, replication forks move in opposite directions away from the origin of replication The molecular structure of DNA...
Part A Why do you suppose that both DNA and RNA have 3'-OH groups and we do not typically find nucleic acids within cells that have 3-H groups Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. Reset Help 3-OH The hydrogen bonds group is critical for because it is involved in the that link together deoxynucleotides or nucleotides into the long polymers that function as...
QUESTION 10 Below is a list of proteins required for DNA replication to occur and functions involved in DNA replication. Match each protein to its function. helicase A catalyzes phosphodiester bonds between two DNA fragments in a strand single strand binding proteins (SSBPs) Rremoves RNA primer and replaces it with DNA topoisomerase cholds DNA polymerase in place during strand elongation - primase D. breaks hydrogen bonds between base pairs and opens the double helix DNA polymerase in E. extends a...