31) answer is 4th option
1600 kb upon digestion with 1st enzyme produces 400 and 1200
On digestion with 2nd enzyme produces 700 bp and 900 bp.
It's obvious that then upon double digestion, it produces in the order 400, 300&900 kbs
32) exons
Because cDNA library will only contain sequences in mRNA
On the other hand,In genomic DNA library they contains both sequences, ie, intron and exon sequences
QUESTION 31 You have a DNA sequence of 1600 bp. To characterize it, you decide to...
The human genome contains about 3x10^9 bp of DNA. How many 200-kb fragments would you have to clone into a BAC library to have a 90% probability of in- cluding a particular sequence?
QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template"). Each lane shows the fragments of the new strand (the "daughter" strand) that are produced when a given ddNTP is added to the PCR reaction. Based on these results, what is the sequence of the template (original) DNA strand? Please write (type) it out, making sure you indicate the 5' and 3" ends ddATP ddTTP ddCTP ddGTP well well well well save Click Save...
Can somebody help me with question 2 and 3?????
Analyse the 300 bp DNA sequence given below to find certain important sequence details on it from a gene function point of view, and certain restriction sites on it, for its physical mapping cloning purposes You may need to use the genetic code (from lecture notes). Address the following activities questions AGCATATCGG CCAATCTCAA ATTTGGGCCC CAAT (Start) ATCATCGTAT TGTTTTTCCTAATGGCCGAAGG HisTyrArg GCCGGCAGCG GATCCGCGCG CTATATACAT CvSTrp SerPhe Glv euProAla TTTTACCCGC le G?VÀrg(Sto AGGCCGIT ATGTCCGAAA...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
help with questions 5 to 10 please
PCB 3023L Lab #4 Protocol & Worksheet (30pt) You may work in your lab groups durine class. but all written answers must be completed individually in your own words. 1) Using the plasmid map for orientation 1 and the cDNA map as a guide, complete the plasmid map for orientation #2. (4pt) 612 1318 1 - EcoRi EcoRI Xbal ECORV -Xbal- 1662 +Bell EcoRI EcoRV Not FP -- Xhol X 2015 PRSP +...
Question 2:
a)
You determine that
xpd
is expressed preferentially in muscle. Your colleague wants to
know
if any of the mutations affect the stability of the RNA
transcript, thereby leading to higher
turnover and lower overall mRNA levels. What techniques could
you use to test her
hypothesis? List the pros and cons of each method. (hint: try to
think of at least three methods
you could use)
b) You find that your collegue is correct, and that the xpda...