Question

Identify the structures in DNA

Need help with all of these questions

Coding strand Transcription 5'-CAGACCAGTTACTGACTGGCATTCAAECATGGATCCAGTATGCCTCGACGGTTATTGGCCGAGCCCCAAGTGGTCGCTCATGGGGAGTOGTCTAGTAGCAATGEATTTAGAGGTCACTAGTCA-3" Transcription start site → stop site 3-GTQTGGTCAATATAATGACETAAGTTCGTACCTAGGTCATACGGAGCTGCCAATAACCGGCTCGGGGTTCÁCCAGCGAGTACCCGTCACCAGATCATCGTTACGTAATGTCCAGTGATCAGT-5' VI VII VIII Template strand Label Identify the structure Function Is the structure part of a mature mRNA? (Y/N) DTY What is the amino acid sequence produced from this locus? Identify N/C terminus and use the three- letter abbreviation on the codon chart VA Tyrone Tyd O ne Oy VAA Stop Trutnohon SA Histidin Hesi GAA Gent ABS Serine (San MA! AAA Lysine (Lys HO 189 A Apel G Grey SAAG,

Answer 1

Label	structure	function	part of mRNA
I	TATA box	RNA pol binds	No
II	5'UTR	stability	yes
III	Shine Dalgarno	Ribosome	yes
IV	Exon-I	protein synthesis	yes
V	intron-I	same	no
VI	Exon-II	same	yes
VII	intron-II	same	no
VIII	Exon-III	same	yes
IX	3'UTR	stability	yes
X	mRNA stop signal	dissocation Of RNA pol	no

Protein sequence

N- Met-Pro-Arg-Arg-Leu-Leu-Val-Ala-His-Gly-Val-!C