Question

(B) Truncated fragments (25 points) You have a nucleotide sequence coding Flis (bacterial flagellin-specific chaperone) in an expression plasmid. You want to express a truncated fragment that will contain the first 40 residues only (an N-terminal fragment) in the same plasmid. What will be the easiest way to make this construct (5 points)? What partially overlapped primers will you use for this task (15 points)? Partially overlapped regions should have 50-52°C melting temperatures, while non-overlapping annealing regions should have 68-70°C melting temperatures. Explain your approach (5 points) atgtacaccgcgagcggtatcaaagcttatgcgcaagtcagcgtggaaagcgccgtgat gagcgccagcccgcatcagttgattgaaatgttgtttgatggcgcgaatagcgctctgg tgcgcgctcgcctgtttttagaacaaggcgatgttgtcgcgaaaggtgaagcgttaagc aaagccatcaatattatcgataacgggctgaaagccggcctcgatcaggaaaaaggcgg tgagattgcgacgaatctttccgagctatacgactatatgattcgccgtttactgcagg ctaatttgcgtaacgacgctcaggccatcgaagaagtggaagggttactcagcaatatt gcagaagcctggaagcagatttcaccgaaagcatctttccaggagtctcgttaa

Answer 1

A) introduce stop codon at 121th position of nucleotide sequence at 3' end of DNA strand

B) this stop codon can be easily used by site directed mutatgenesis where a new reverse primer designed using overlapping sequence.

It will all the sequence complementary to 3' end of gene sequence except in last we introduce stop codon ATT. Doing this mchange leads to decrease of Tm value as last three Nucleotide (stop codon) will not complement or bind to DNA in 1st cycle of PCR so annealing temp should be 50-52C.

Hope it's clear ..thanks