Answer :)
This is only 40 nucleotide base sequence. Therefore, we can use PCR or qPCR to make copies of the 40 bps sequence.
To do PCR by using partially overlapped primers (POP), we need to develop three types of primers. POP-P (primary), POP-P (secondary), and POP-P (tertiary) are needed to develop. These primers are should be 25bp long and each primer should have 10 base pairs identical 3’ region i.e. overlapped regions. The other 15 bp sequence of each primer will be heterologous 5’ ends. The 10 base pairs of overlapped regions should have G-C content between 50 to 60%.
The G-C content of the overlapped regions will control the annealing temperature 50-52 0C. The non-overlapped regions cannot have more than 600C because there shall maximum of 15 G-C nucleotides in 15 bp non-overlapped regions. There is something wrong with the question. The only possibility to have 68-70 0C temperature if it considers with the whole primers i.e. the 25 bp sequences.

(B) Truncated fragments (25 points) You have a nucleotide sequence coding Flis (bacterial flagellin-specific chaperone) in...
(B) Truncated fragments (25 points) You have a nucleotide sequence coding Flis (bacterial flagellin-specific chaperone) in an expression plasmid. You want to express a truncated fragment that will contain the first 40 residues only (an N-terminal fragment) in the same plasmid. What will be the easiest way to make this construct (5 points)? What partially overlapped primers will you use for this task (15 points)? Partially overlapped regions should have 50-52°C melting temperatures, while non-overlapping annealing regions should have 68-70°C...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
In part A, yes you should reconstitute the full-length protein
sequence from the fragments. However, you do not need to write out
the amino acid sequence - you can just provide the order of the
fragment numbers (from either set of fragments). For
example (and this is not the answer), you could say:
"Using the Pro-IAPP fragment set, starting from the N-terminus, the
fragment order is '5-4-6-3-2-1' " and that would fully address the
question.
In part B, the hint...