Question

Question 2 If a piece of RNA was supposed to read GAGUAU and produce Phe-Tyr, what...

Question 2

  1. Genetic Code Grid - Contact your instructor for an accessible version if needed

    If a piece of RNA was supposed to read GAGUAU and produce Phe-Tyr, what happens if a base substitution causes the RNA to read GAGUAG instead?

    Phe-Tyr

    Phe-His

    Phe-stop

    Phe-Cys-…

0 0
Add a comment Improve this question Transcribed image text
Answer #1

I believe the correct answer to be:

Option C) Phe-stop.

As UAG is a stop codon so it would not code for any amino acid and the translation would stop at this codon.

feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.

Add a comment
Know the answer?
Add Answer to:
Question 2 If a piece of RNA was supposed to read GAGUAU and produce Phe-Tyr, what...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide...

    please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...

  • This sequence is RNA because:

    20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • 2) On your first day working in my lab, you obtain the following DNA sequence: 3'...

    2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...

  • What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...

    What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...

  • If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A....

    If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...

  • Question 25 3 pts Given the following DNA template, the sequence of the protein made is:...

    Question 25 3 pts Given the following DNA template, the sequence of the protein made is: 5'-AGC TCG AAT TCG CTT CAT GCT AGC TAG------(+1)--------(-10) ----------(-35) Leu-Ala-Cys-Met-Lys-Arg.lle-Arg-Ala Asp-Arg-Ser-Tyr-Phe-Ala-Stop Met-Ala-Ser-Stop Met-Lys-Arg-lle Arg-Ala Ser-Ser-Asp-Ser-Leu-His-Alo Ser-Stop 3 pts Question 30 In a cancer genomes database, you find multiple mutations in the BMV gene in several types of cancers. The majority of these cancer-associated mutations are heterozygous (having also one wild type allele), and expression of these mutant versions of BMV in normal cells...

  • Question 8 4 pts After a single base pair change, the following amino acid sequence was...

    Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"

  • multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino...

    multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino acid sequence (using the three-letter abbreviations) for the resulting dipeptide? Becond GU الا لا 16 First Base BE LE ACC Third Base > COCO لا لا لا | GCA GCG GAG- GGG - Lys-Tyr Phệ-Met His-Glu Lys-Tyr 8 Phe-Met His-Glu Met-His + Change seat Send a message to the instructor < Join another session

  • Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, ch...

    Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT