Question

Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence
0 0
Add a comment Improve this question Transcribed image text
Answer #1

(8) Tyrosine coaded by - UAU , VAC (N-RNA Codon) . Stob Cadons are.. VAA, VAG, UGA C RNA Codon) Template strand is strand sun

Add a comment
Know the answer?
Add Answer to:
Question 8 4 pts After a single base pair change, the following amino acid sequence was...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Shown below are the amino acid sequences of the wild-type and three mutant forms of a...

    Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition/transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met - gin-ala - ser-val - arg - phe Mutant 1: met - gln - pro-ser -...

  • Shown below are the amino acid sequences of the wild-type and three mutant forms of a...

    Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition / transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met – gln – ala – ser – val – arg – phe Mutant 1:...

  • This sequence is RNA because:

    20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...

  • 3. A small peptide has the amino acid sequence Phe-Leu-Tyr-Ala-Leu-Gly-Glu. A shorter variant of this peptide...

    3. A small peptide has the amino acid sequence Phe-Leu-Tyr-Ala-Leu-Gly-Glu. A shorter variant of this peptide was discovered that had the sequence Phe-Leu-Tyr-Ala; it was demonstrated that this shorter peptide was due to a single base substitution in the second Leu codon. What type of mutation (missense, nonsense, frameshift) gave rise to this shorter peptide? Which of the six possible Leu codons was used in the synthesis of the original (long) peptide (can you eliminate some as possibilities)?

  • In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

    In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • Which of the following amino acid changes could result from a mutation that changed a single...

    Which of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (first, second, or third nucleotide) in the mRNA must be altered for the change to result. a) Trp → Stop b) Ser → Phe c) Asp → Tyr d) Ile → Thr

  • Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start...

    Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start codon is position +1. a substitution from G to T in the arginine codon of the antisense stand a substitution of a G nucleotide at position +9 in the antisense strand a transition at position +6 in the sense strand a transversion of A in the histidine codon of the antisense strand a single nucleotide deletion at position +12 in the antisense strand a...

  • multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino...

    multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino acid sequence (using the three-letter abbreviations) for the resulting dipeptide? Becond GU الا لا 16 First Base BE LE ACC Third Base > COCO لا لا لا | GCA GCG GAG- GGG - Lys-Tyr Phệ-Met His-Glu Lys-Tyr 8 Phe-Met His-Glu Met-His + Change seat Send a message to the instructor < Join another session

  • What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...

    What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT