Which of the following amino acid changes could result from a mutation that changed a single...
Which of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (first, second, or third nucleotide) in the mRNA must be altered for the change to result.
-
a) Trp → Stop
-
b) Ser → Phe
-
c) Asp → Tyr
-
d) Ile → Thr
Homework Answers
Add Answer to:
Which of the following amino acid changes could result from a
mutation that changed a single...
, , v Question Completion Sta QUESTION 9 For each of the following amino acid changes...
, , v Question Completion Sta QUESTION 9 For each of the following amino acid changes determine how a mutation in a single base of the mRNA codon (first, second or third nucleotide position) could be altered for the amino acid change to result. Match each change with the position in which the mutation must occur A. 2 B. 1 C. 3 Leu >GIn Phe..>lle ile > Asn AsLys Pro >Ala Phe>Ser 1.5 points Save Answer Click Save and Submit...
1. *A glycine residue is in position 210 of the tryptophan Second position synthetase enzyme of w...
1. *A glycine residue is in position 210 of the tryptophan Second position synthetase enzyme of wild-type E. coli. If the codon specifying glycine is GGA, how many single-base substitutions will result in an amino acid change at position 210? (0.4 pt) UAU tyr uGC Juc Phe UCU UUA UAA Stop UGA St UAG Stop UGG trp CAU CUU leu | CCC pro ICAA gin | CGG CUG CCA ProCAc hisCCU AUC ile ACC AUG met ACG leu CCU CUC...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Which of the following amino acid replacements could result from single-base substitutions induced by hydroxylamine? Pro->...
Which of the following amino acid replacements could result from single-base substitutions induced by hydroxylamine? Pro-> Leu Ala->Asp Lys->Glu Ser-> Tyr Gly-> Arg
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
21. One form of thalassemia has a single G->A mutation in the B-globin gene at the...
21. One form of thalassemia has a single G->A mutation in the B-globin gene at the first nucleotide in the intron. This destroys the S' splice junction. The mRNA remains unspliced, leaving nucleotide intron in place. Assuming no stop codons are introduced in the intron pro second exon would be in-frame or out of frame in the translated protein dict if the A. In frame B. Out of frame Phe Ser Ty Cys U Phe Ser Cys Leu Se Stop...
Question 8 4 pts After a single base pair change, the following amino acid sequence was...
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, ch...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
, , v Question Completion Sta QUESTION 9 For each of the following amino acid changes determine how a mutation in a single base of the mRNA codon (first, second or third nucleotide position) could be altered for the amino acid change to result. Match each change with the position in which the mutation must occur A. 2 B. 1 C. 3 Leu >GIn Phe..>lle ile > Asn AsLys Pro >Ala Phe>Ser 1.5 points Save Answer Click Save and Submit...
1. *A glycine residue is in position 210 of the tryptophan Second position synthetase enzyme of wild-type E. coli. If the codon specifying glycine is GGA, how many single-base substitutions will result in an amino acid change at position 210? (0.4 pt) UAU tyr uGC Juc Phe UCU UUA UAA Stop UGA St UAG Stop UGG trp CAU CUU leu | CCC pro ICAA gin | CGG CUG CCA ProCAc hisCCU AUC ile ACC AUG met ACG leu CCU CUC...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
21. One form of thalassemia has a single G->A mutation in the B-globin gene at the first nucleotide in the intron. This destroys the S' splice junction. The mRNA remains unspliced, leaving nucleotide intron in place. Assuming no stop codons are introduced in the intron pro second exon would be in-frame or out of frame in the translated protein dict if the A. In frame B. Out of frame Phe Ser Ty Cys U Phe Ser Cys Leu Se Stop...
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago