Question

aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this DNA
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer 1: The mRNA transcribed from the given sequence would be

AAU CUA GCA UUU CAC GUU ACC CUA GUA UAC

Answer 2: Three nucleotides constitutes one codon, hence the number of codons in the given sequence are 10.

Answer 3: The given sequence of codons can make up a protein with 10 amino acids.

(there are total 61 codons for 20 different amino acids and three are nonsense codon or stop codons,they are UAG,UAA,UGA)

Answer 4: The sequence of amino acids would be as follows

Aspargine-leucine-alanine-phenylalanine-histidine-valine-threonine-leucine-valine-tyrosine

Answer 5: The tRNA anticodons needed to construct this protein would be as follows

UUA GAU CGU AAA GUG CAA UGG GAU CAU AUG

Add a comment
Know the answer?
Add Answer to:
aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • Break the following DNA sequence into triplets. (Draw a line to separate triplets) CCG|ATA|CGC|GGT|ATC|CCA|GGG|CTA|ATT|CAA If the...

    Break the following DNA sequence into triplets. (Draw a line to separate triplets) CCG|ATA|CGC|GGT|ATC|CCA|GGG|CTA|ATT|CAA If the above code showed the bases on one strand of DNA, what would the complementary strand read? What would the code in problem #2 be transcribed into (What would the mRNA sequence be?) How many codons are there in the above problem? What is the three-letter sequence on a tRNA molecule called? How many different amino acids are there that make up all of the...

  • 1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or...

    1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or B) serves as the TEMPLATE strand for the transcription of a mRNA that contains both a start and a stop codon?    3.) Which number (1, 2, 3, 4, or 5) best approximates the location of the -10 consensus sequence?    4.) How many amino acids long is the protein encoded by the mRNA from this DNA sequence?    5.) What is the second...

  • Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids....

    Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids. The words Introduction: The instructions coded in DNA must be read and turned into pro molecules for the cell to carry out the instructions. In this activity you will model this process using sentences for DNA and RNA and words for amino acids. The words must line up in the correct order for the protein to form properly, just like words in a sentence...

  • 7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first...

    7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA:...

    Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA: GCG GCG TAC CCC AAA ATA GGG GCG CTC GCG ATT AAA CCG TTC CCC What is the untranscribed strand? What is the mRNA sequence that would be transcribed from the transcribed strand? What is the sequence of tRNA nucleotides that would match up with the mRNA? What is the amino acid sequence that would result from translation of the mRNA?

  • c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...

    c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

  • DNA TGC GTG TAC CTA CCA mRNA ACG CAC AUG GAU GGU tRNA UGC GUG UAC...

    DNA TGC GTG TAC CTA CCA mRNA ACG CAC AUG GAU GGU tRNA UGC GUG UAC CUA CCA Amino Acids Cys- Val - Tyr - Leu - Pro Question 5 strand. It is also The section of a gene shown above (TGC GTG TAC CTA CCA) is called the answered known as the strand Marked out of 1.50 The amino acids are determined from the e strand using the Biology 30 data booklet. P Flag q

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT