Question

media%2Fe88%2Fe8878d0e-b946-4e01-8c92-5c
0 0
Add a comment Improve this question Transcribed image text
Answer #1

2. Break the following DNA sequence into triplets. (Draw a line to separate triplets) CCG ATAC G CG G TATCC CAG G G C TAATTİA

Add a comment
Know the answer?
Add Answer to:
Break the following DNA sequence into triplets. (Draw a line to separate triplets) CCG|ATA|CGC|GGT|ATC|CCA|GGG|CTA|ATT|CAA If the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The base sequence of a polynucletide chain is given as follows: 3'-TAC GGG CTA CAA CTT...

    The base sequence of a polynucletide chain is given as follows: 3'-TAC GGG CTA CAA CTT AAC AGA CCA ATC-5' what will be produced if this DNA molecule is replicated. the answer should either be the nitrogeneous base sequence of nucleotide chain or amino acid sequence of peptide chain.if the answer is nitrogeneous base sequenceof peptide chain, label the ends of it (5'and 3') what is the amino acid sequenceof the polypeptide chain that will be synthesized according to the...

  • Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA:...

    Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA: GCG GCG TAC CCC AAA ATA GGG GCG CTC GCG ATT AAA CCG TTC CCC What is the untranscribed strand? What is the mRNA sequence that would be transcribed from the transcribed strand? What is the sequence of tRNA nucleotides that would match up with the mRNA? What is the amino acid sequence that would result from translation of the mRNA?

  • The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A....

    The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A. Give the mRNA codons and tRNA anticodons that correspond with this sequence. B. Using the above piece of DNA, show a deletion, insertion, a substitution, and nonsense mutation. Which ones are frame-shift mutations? Are any of your mutations missense? Use the table of codons and amino acids in the textbook to answer this part of the question. For microbiology

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...

    mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...

  • The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a....

    The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...

  • aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this...

    aus: 99 Consider the following DNA sequence: TTAGATCGTAAAGTGCAATGGGATCATATG What would be the mRNA transcribed from this DNA sequence? ots)? 10 AAU CUA G CA unU CAC Gui ACC CUA GUAU- How many codons does the sequence contain 21 th A How many amino acids make up this protein? (1 pt) List the amino acids, in order, that make up this protein using the chart provided. (5 pts) Referring to the mRNA strand constructed in Question #3, list the tRNA anti-codons...

  • Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids....

    Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids. The words Introduction: The instructions coded in DNA must be read and turned into pro molecules for the cell to carry out the instructions. In this activity you will model this process using sentences for DNA and RNA and words for amino acids. The words must line up in the correct order for the protein to form properly, just like words in a sentence...

  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

    Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT